SimpleSearch - Line and FST details


Line specific information

 
Line ID 260F08
Vector Used pAC161
Line Availability only available from NASC (N424932)
Segregation Analysis 100:95:71
Confirmed for Hit At5g35410
Parent of DUPLO pair none
Parent of pair(s) 4309, 4436, 89886, 89908, 89948, 89966, 90003, 90018, 90050, 90065, 90089, 90102, 90103, 90104, 90107, 90112

Gene hit At5g35410

 
Sequence (A. th genome BLAST matches underlined)
>62-K014949-022-260-F08-8409
TTGATCCATGTAGATTNTCCCGGACATGAACGCCTTTACAATTGAATATATCCTGTCTTC
AAAAACTTGTACTTCAATTGTTAAACTAAAACCTCAGTATCTGTCTTAGCTAAAGTTACT
TTTACTTGTTTTTCATTAAGTTGACCTGTCAATTGCACTTGTTCACAGGGCAGTTATGTA
GCGGAGAATGTAGAGAGAAATGATGAAGGGCCCCTGATGATGAATGCCTTTGAGATGATT
ACCTTATCACAAGGCTTAAATTTATCTGCACTATTTGACAGGCGACAGGTAGTACCTGAT
TTTCTATTACTGGTCATAGAGATCTCCATTTCGAATAAAAGAATGTCGGTAGCATCTATT
CTTCAGACTGCCCGTTTTGACTGCCTTATGATGCTGTGTTCTTAGTTTGTTATAATAACT
ATAAGTTCATTAGATGATTGGTTGCATGGCATTAGTAGATACAAATGGAATCCAAAATGT
TCCTGCATATTGATGGCTGATCCTTTGATCTCGCAGGATTTTGTTAAAAGGCAAACCCGT
TTTGTTTCTCGAAGGGAACCTATGGGATCCT
GenBank Accession AL941773 [GenBank]
Graphic View Graphic view of gene At5g35410
Predicted Position of Insertion Chr5:13636868 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) K21B8
Hit Gene Code At5g35410 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit T3F17

 
Sequence (A. th genome BLAST matches underlined)
>62-K014924-022-260-F08-8409
TTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATATATATTCTGTAA
TAGAGTATGTTCCAACGCGAAGATTTGGCTAAACAGGTATTGGGCTATGGGATCCTCCCT
ATAGTGATGATATGCACTTACGCGTTCATTATGGCCCCGTGTAACGAGGACCTCATTTCT
CTATCCTCACTTTACACACATAGCTTGACACTGTATTCTATTGCCTAGGTGAGACCTTGC
TATAGCCGCAGCGATTCAAGCTTTGGGATCCTCCCTATATGGTCCACTGTAGGCACTTGA
GCTTCATCATTACGCATCGTAGGAAGCCTTGAGCCCATATTATAAGACTGACCTCTAAAG
CTA
GenBank Accession FR806719 [GenBank]
Graphic View Graphic view of sequence FR806719 of line 260F08
Predicted Position of Insertion Chr2:18998979 - go to primer design
BLAST e Value 7e-18
Hit Clone Code (BAC ID) T3F17
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 14.10.2014 10:23