Sequences from confirmation amplicon


Confirmation sequences for line 274F12 and hit At1g26310 are shown.
Line ID 274F12
Locus At1g26310 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:9103419
Primers used for PCR PH31 - 8474, show primer details
   
Sequence Name 29-K019985-022-274-F12C-PH31
GenBank Accession LN499096 [GenBank]
Sequencing primer gene specific primer, PH31: 5'-TAGCTTTCCTAAAAGCAAAAACCC-3'
Sequence (A. th genome BLAST matches underlined)
>29-K019985-022-274-F12C-PH31
CTAGACCATAAACATCCGTTCTTTCTGTACCTAATATACTAAACTTGACTTGAAGCAAAA
TGTACATTTCCAGATTAAAGAAGATGCTGAAGATTTCTTACAAATCCATGCCACTATAAT
TAAGTAGATCGTATTGTAGGGTTCACTAAAAGTCCTAAAAATTTTCATTTTCTTTGATAT
ATAATAAATTATTGATAAAAATAAACTAATGATATGACCAACACAATCAGTTCGTAGACC
CAAGTAAATAGATACCAAATCAGTGGCAAATTTTCAGAAAGACAGATAATAGAATAGAAG
ACACAGAAAGTATGCCTTAAGTAGAACAAAGACTACTAGTTAGGGCAAACGAAGGCACAC
TAAAAATAACATTAAAAAAAGAAGGAATTAAGCAATTACCAAGATTCAGAGGAGTACTCG
AACAATTTGCCCTTATGGGAGAAGACAATAAGGGAAACCTCGGCATCACAAAGAACAGAG
ATCTCCTGAGCTTCATGTCAATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTA
CATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATT
TTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTG
ATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCT
AATTCGGAAATCTTTATTTCGACGTGTCTACA
   
Sequence Name 30-K019985-022-274-F12C-8409
GenBank Accession LN499534 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>30-K019985-022-274-F12C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATTGACATGAAGCTCAGGAGAT
CTCTGTTCTTTGTGATGCCGAGGTTTCCCTTATTGTCTTCTCCCATAAGGGCAAATTGTT
CGAGTACTCCTCTGAATCTTGGTAATTGCTTAATTCCTTCTTTTTTTAATGTTATTTTTA
GTGTGCCTTCGTTTGCCCTAACTAGTAGTCTTTGTTCTACTTAAGGCATACTTTCTGTGT
CTTCTATTCTATTATCTGTCTTTCTGAAAATTTGCCACTGATTTGGTATCTATTTACTTG
GGTCTACGAACTGATTGTGTTGGTCATATCATTAGTTTATTTTTATCAATAATTTATTAT
ATATCAAAGAAAATGAAAATTTTTAGGACTTTTAGTGAACCCTACAATACGATCTACTTA
ATTATAGTGGCATGGATTTGTAAGAAATCTTCAGCATCTTCTTTAATCTGGAAATGTACA
TTTTGCTTCAAGTCAAGTTTAGTATATTANGTACAGAAAGAACGGATGTTTATGGTC

Last Updated on 07.07.2016 14:16