SimpleSearch - Line and FST details


Line specific information

 
Line ID 274F12
Vector Used pAC161
Line Availability only available from NASC (N426280)
Segregation Analysis 50:49:44
Confirmed for Hit At2g13370 At1g26310
Parent of DUPLO pair none
Parent of pair(s) 3575, 3821, 7150

Gene hit At2g13370

 
Sequence (A. th genome BLAST matches underlined)
>94-K015098-022-274-F12-8409
CTGATCCATTGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATACTATCCTGACTA
TGGGATCCTCCCTATACGTGAGTTTAAAAAAAATGAGTTTTCCGGGTATCTATGTTCGTT
GAGCTTCTGAATCGATGATCAGACCTCAGATTCTTCCGGCTAATGCCCAGCATAATGCAT
GGTACCCTAACATAAAAAACTTATCTTGGGGGAAATCCGGTGGGACATGCCCTATGGCTC
TTATCCAATGGACCCCGGCCGATGATTTCCAACTAGTTATAGTTTGTTTTCTGTGGACTC
TCATTATTGGCCTGGATGACACCTCTTTTTTTCTACTTGCGATCCCCCTTTTTTGGGACC
TATGGGACCCTGCCATCATGGAGNGATCCTTGGGAGTTCCCTGCTGTTTTGAATTCTTGT
TGCCTCTGGAACTCCCTATGGGATCCTACCTATAG
GenBank Accession AL943480 [GenBank]
Graphic View Graphic view of gene At2g13370
Predicted Position of Insertion Chr2:5544461 - go to primer design
BLAST e Value 4e-32
Hit Clone Code (BAC ID) F14O4
Hit Gene Code At2g13370 [TAIR] [MIPS] [SIGnAL]
Gene Annotation chromatin remodeling 5
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g26310

 
Sequence (A. th genome BLAST matches underlined)
>94-K015094-022-274-F12-8409
CTGATCCATGTAGATTTCCCGGACATGAAGCACTTTACACTTGANTATATCCTGGCTATA
GTATTCTCACTATAGTGAGATGNGATGCCGAGGTTTCCCTTATTGTCTTCTCCATAAGGG
CAAATTGTTCGAGTACTCCTCTGAATCTTGGTAATTGCTTAATTCCTTCTTTTTTTAATG
TTATTTTTAGTGTGCCTTCGTTTGCCCTAGCTATGGGATCCTCCCTATAGTGAGA
GenBank Accession AL943479 [GenBank]
Graphic View Graphic view of gene At1g26310
Predicted Position of Insertion Chr1:9103418 - go to primer design
BLAST e Value 3e-48
Hit Clone Code (BAC ID) F28B23
Hit Gene Code At1g26310 [TAIR] [MIPS] [SIGnAL]
Gene Annotation K-box region and MADS-box transcription factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23