Sequences from confirmation amplicon


Confirmation sequences for line 275E03 and hit At5g64330 are shown.
Line ID 275E03
Locus At5g64330 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:25728630
Primers used for PCR PH33 - 8474, show primer details
   
Sequence Name 39-K017546-022-275-E03C-PH33
GenBank Accession LN503185 [GenBank]
Sequencing primer gene specific primer, PH33: 5'-TGAGGAAGGGAATCTAATCTTCAA-3'
Sequence (A. th genome BLAST matches underlined)
>39-K017546-022-275-E03C-PH33
TCTCAGCTATGTGGTTCTGTCTTCATGGAGAGACTCCATCTTGGTCCTGAAGAGCTGTGA
AAAGCTCTCACCTTGGGCTGAGAATCTTCAGATTGTGAGAAGGTGTAGTGAATCTATCGC
TTGGAAAGCTTGTAGTAATCCAAAAGGTATTAGATGGGCTTACACAGGGAAAGCTCCATC
TCCATCAACAACAAATTTCGCGGGTTCTAGTCCGAGATGGAACGAATCAAAAGATTCAAG
TTTCTATTGTAGTCCGAGTAGGAACACTAATAGCCAGCCTGTTCCTCCAGATTGGTGGTT
CGAAGATGTCTCCATCTTAAGAATCGATCATTTCGTTCGTGTAATCACTGCAATCAAGGT
ACTACTACACATAGGTTATTTTTCTCTCAAGCATTTTCACAAACACTTGGTGTACATATC
TCAATGAGTAAATGGATTCATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACAT
GGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTT
TTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATA
AAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAAT
TCGGAAATCTTTATTTCGACGTGTCTACAT
   
Sequence Name 43-K017546-022-275-E03C-8409
GenBank Accession LN504670 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>43-K017546-022-275-E03C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATGAATCCATTTACTCATTGAGAT
ATGTACACCAAGTGTTTGTGAAAATGCTTGAGAGAAAAATAACCTATGTGTAGTAGTACC
TTGATTGCAGTGATTACACGAACGAAATGATCGATTCTTAAGATGGAGACATCTTCGAAC
CACCAATCTGGAGGAACAGGCTGGCTATTAGTGTTCCTACTCGGACTACAATAGAAACTT
GAATCTTTTGATTCGTTCCATCTCGGACTAGAACCCGCGAAATTTGTTGTTGATGGAGAT
GGAGCTTTCCCTGTGTAAGCCCATCTAATACCTTTTGGATTACTACAAGCTTTCCAAGCG
ATAGATTCACTACACCTTCTCACAATCTGAAGATTCTCAGCCCAAGGTGAGAGCTTTTCA
CAGCTCTTCAGGACCAAGATGGAGTCTCTCCATGAAGACAGAACCACATAGCTGAGAAAA
GCTTCTGTCTTGAAGATTAGATTCCCTTCCT

Last Updated on 23.10.2014 13:25