SimpleSearch - Line and FST details


Line specific information

 
Line ID 275E03
Vector Used pAC161
Line Availability only available from NASC (N426355)
Segregation Analysis 50:49:41
Confirmed for Hit At5g64330
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g64330

 
Sequence (A. th genome BLAST matches underlined)
>21-K015100-022-275-E03-8409
TTGATCCATGTAGCATTTCCCGGACCTGAAGCACTTTACAACTTGAATACTAGAATCCGT
TTACTCATTGAGATATGTACACCAAGTGTTTGTGAAAATGCTTGAGAGCAAAAATACCTA
TGTGTAATAATAACCTTGATTGCAGTGATTACACCAACGAACTGATCGATTCTTAAGATG
GAGACATCTTCCAACCACCAATCTGGAGGAACAGGCTGGCTATTAGTGTTCCTACTCGGA
CTACAATAGAAACTTGAATCTTTTGATTCGTTCCATCTCGGACTATGGGATCCTC
GenBank Accession AL943581 [GenBank]
Graphic View Graphic view of gene At5g64330
Predicted Position of Insertion Chr5:25728638 - go to primer design
BLAST e Value 1e-96
Hit Clone Code (BAC ID) MSJ1
Hit Gene Code At5g64330 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Phototropic-responsive NPH3 family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL943580 [GenBank]


Last Updated on 14.10.2014 10:23