Sequences from confirmation amplicon


Confirmation sequences for line 277A11 and hit At1g30670 are shown.
Line ID 277A11
Locus At1g30670 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:10879493
Primers used for PCR ZZ68 - 8474, show primer details
   
Sequence Name 31-K021737-022-277-A11C-8409
GenBank Accession LN499976 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>31-K021737-022-277-A11C-8409
GCCATTTACAATTGAATATATCCTTTGAACTATCCAGAGTCTGCAAAATTTAAACAAGTA
TCGTATAAAAAAAGGAAGGAAAATACTGCAAGGAACCATTTGGATTTAGGGTTTATCTTA
TACCTGCATTTTGGTCTGCTTCAGTTGGAGAATCTCAATTTGAGCCTGCAAGAACTTGAC
ATATTTAGCTGCGGCATTGAACATTTCGGCAGTGTTGTGTTTCTGGCTTCCAGGGATTAG
TTTTCCCAGCTCTTGAGTCTTCTCTGTGATTCTTCTTCTCCTCTTTCGTGCTGCGATGCT
CTGAGCAGATAGCTCTCGCTTCTTGGTGTCGCCTTGTTCAGTCCACCCAACCTTGAACGT
CGATGAGAAATCAGGAGCTTGAAACTTGGAAATGTTGGAAGCTCTGNTTGATG
   
Sequence Name 32-K021737-022-277-A11C-ZZ68
GenBank Accession LN500403 [GenBank]
Sequencing primer gene specific primer, ZZ68: 5'-TACATCACAGAAGCTTCCAACATT-3'
Sequence (A. th genome BLAST matches underlined)
>32-K021737-022-277-A11C-ZZ68
TCGACGTTCAGGTTGGGTGGACTGAACAAGGCGACACCAAGAAGCGAGAGCTATCTGCTC
AGAGCATCGCAGCACGAAAGAGGAGAAGAAGAATCACAGAGAAGACTCAAGAGCTGGGAA
AACTAATCCCTGGAAGCCAGAAACACAACACTGCCGAAATGTTCAATGCCGCAGCTAAAT
ATGTCAAGTTCTTGCAGGCTCAAATTGAGATTCTCCAACTGAAGCAGACCAAAATGCAGG
TATAAGATAAACCCTAAATCCAAATGGTTCCTTGCAGTATTTTCCTTCCTTTTTTTATAC
GATACTTGTTTAAATTTTGCAGACTCTGGATAGTTCAAAGGATATATTCAATTGTAAATG
GCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAA
AAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATT
ATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGA
AAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTC

Last Updated on 07.07.2016 14:16