SimpleSearch - Line and FST details


Line specific information

 
Line ID 277A11
Vector Used pAC161
Line Availability only available from NASC (N426507)
Segregation Analysis 50:38:28
Confirmed for Hit At1g30670
Parent of DUPLO pair 11795
Parent of pair(s) none

Gene hit At1g30670

 
Sequence (A. th genome BLAST matches underlined)
>81-K015121-022-277-A11-8409
NTGATCCATGTAGCATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTTTGAAC
TATCCAGAGTCTGCAAAATTTAAACAAGTATCGTATAAAAAAAGGAAGGAAAATACTGCA
AGGAACCATTTGGATTTAGGGTTTATCTTATACCTGCATTTTGGTCTGCTTCAGTTGGAG
AATCTCAATTTGAGCCTGCAAGAACTTGACATATTTAGCTGCGGCATTGAACATTTCGGC
AGTGTTGTGTTTCTGGCTTCCAGGGATTAGTTTTCCCAGCTCTTGAGTCTTCTCTGTGAT
TCTTCTTCTCCTCTTTCGTGCTGCGATGCTCTGAGCAGATAGCTCTCGCTTCTTGGTGTC
GCCTTGTTCAGTCCACCCAACCTTGAACGTCGATGAGAAATCAGGAGCTTGAAACTTGGA
AATGTTGGAAGCTTCTGTGATGTAAGAATCCAAGAGGTAATTAGATTCAGGGCTATGGGA
TCCTC
GenBank Accession AL943794 [GenBank]
Graphic View Graphic view of gene At1g30670
Predicted Position of Insertion Chr1:10879493 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T5I8
Hit Gene Code At1g30670 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03