Sequences from confirmation amplicon


Confirmation sequences for line 277B03 and hit At3g10630 are shown.
Line ID 277B03
Locus At3g10630 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:3321725
Primers used for PCR PP04 - 8474, show primer details
   
Sequence Name 13-K102660-0022-277-B03C-8409
GenBank Accession LN491989 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>13-K102660-0022-277-B03C-8409
GCCATTTAAATTCTTGTTCTTATTTTCTCATCAAAGATTCTCGCTATTTGATCCGCTACA
ACCTTAGCAACAACCTCAGGAGCAAAATTCTTGACCATGTCATCTCTTCCACGTTTTCCT
TTAACCTTAGCCTCATCAGGGTTACTCATTACACGCCTCATTAGAACCCTCAGCTTATCC
ACAGATGGCTCTGCCCATTGATGCCCTTCAAAAGGACCTTCCTTCACTTCACTCATCTCC
TCTACCACCAACGGGTAACCATTCCGCTCTGTAAGATACTCTGTTGGTCCTGACCAGTTT
GTTGTGATCACAGGCAAAGACATAGCCATGGCTTCCACTATAGGTCGTCCCCATCCTTCT
CCTCTTGTAGGCAACACAAACGCATCAGCCGCTTTGTACAACCGAGGTAAATCAACTTGA
GCAATGTGTTTATCAATCACATACACAAAAGGGTAACCATTCCGAGGCTCTTCTATATTC
ATTTCTTCTACGAAATCAAGAATCTTGTTCCCGAAATCGCTGTCCGAGTGATACGCGTTC
GTCAACAAAAACAGAGCAACATTGTCTTCACCAGAAAACTCACTCAAGTAAGCTTTCAAC
AATACAT
   
Sequence Name 32-K102661-0022-277-B03C-PP04
GenBank Accession LN500536 [GenBank]
Sequencing primer gene specific primer, PP04: 5'-AAGGTTGGGATGTATTGTTGAAAG-3'
Sequence (A. th genome BLAST matches underlined)
>32-K102661-0022-277-B03C-PP04
TGTTGCTCTGTTTTTGTTGACGAACGCGTATCACTCGGACAGCGATTTCGGGAACAAGAT
TCTTGATTTCGTAGAAGAAATGAATATAGAAGAGCCTCGGAATGGTTACCCTTTTGTGTA
TGTGATTGATAAACACATTGCTCAAGTTGATTTACCTCGGTTGTACAAAGCGGCTGATGC
GTTTGTGTTGCCTACAAGAGGAGAAGGATGGGGACGACCTATAGTGGAAGCCATGGCTAT
GTCTTTGCCTGTGATCACAACAAACTGGTCAGGACCAACAGAGTATCTTACAGAGCGGAA
TGGTTACCCGTTGGTGGTAGAGGAGATGAGTGAAGTGAAGGAAGGTCCTTTTGAAGGGCA
TCAATGGGCAGAGCCATCTGTGGATAAGCTGAGGGTTCTAATGAGGCGTGTAATGAGTAA
CCCTGATGAGGCTAAGGTTAAAGGAAAACGTGGAAGAGATGACATGGTCAAGAATTTTGC
TCCTGAGGTTGTTGCTAAGGTTGTAGCGGATCANATAGCGAGAATCTTTGATGAGAAAAT
AAGAACAAGAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTA
TGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCANAAATG
TAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACNAATTACGA
TCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTNTATNT
CGACGTGTCTACATTC

Last Updated on 23.10.2014 13:25