SimpleSearch - Line and FST details


Line specific information

 
Line ID 277B03
Vector Used pAC161
Line Availability only available from NASC (N426511)
Segregation Analysis 50:40:29
Confirmed for Hit At3g10630
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g10630

 
Sequence (A. th genome BLAST matches underlined)
>18-K015121-022-277-B03-8409
NTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATATAGCCCAAGAAC
TCCACCACTCTCGTATTCTATGGGATCCTCCCTATAGTGACGACCTCAGGAGCAAAATTC
TTGACCATGTCATCTCTTCCACGTTTTCCTTTAACCTTAGCCTCATCAGGGTTACTCATT
ACACGCCTGATTAGAACCCTCAGCTTATCCACAGATGGCTCTGCCCATTGATGCCCTTCA
AAAGGACCTTCCTTCACTTCACTCATCTCCTCTACCACCAACGGGTAACCATTCCGCTCT
GTAAGATACTCTGTTGGTCCTGACCAGTTTGTTGTGATCACAGGCAAAGACATAGCCATG
GCTTACACTATAGGTCGTGCCCATCCTTCTCCTCTTGTAGGCAACACAAACGCATCAGCC
GCTTTGTACAACCGAGGTAAATCAACTTGAGCAATGTGTTTATCAATCACATACACAAAA
GGGTAACCATTCCGAGGCTCTTCTATATTCATTTCTTCTACGAAATCAAGAATCTTGTTC
CCGAAATCGCTGTCCGAGTGATACGCGTTCGTCAACAAAAACAGAGGCACATTGTCTTTC
CCAGAAAACTCACTCCAGGACGCTTTCAACAGTACATCCCAACCTTTCCTCTGGTCCCAT
TTAAACACACTCAAGACCACCAACCCATTCTTTATCCCAGAACCTGAAACCGAAGTCCCA
ACCGCCATCAGATTCCAAGGCTTATACTTGGAAGGAATCGAAAAAACCGGAATTCGCCGG
GCTGCACAATCTTGGCCACGCTAGAGGAACCAACCCCACTTT
GenBank Accession AL943800 [GenBank]
Graphic View Graphic view of gene At3g10630
Predicted Position of Insertion Chr3:3321739 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F13M14
Hit Gene Code At3g10630 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-Glycosyltransferase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03