Sequences from confirmation amplicon


Confirmation sequences for line 278H02 and hit At4g01420 are shown.
Line ID 278H02
Locus At4g01420 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:580712
Primers used for PCR JK12 - 8474, show primer details
   
Sequence Name 35-K020436-022-278-H02C-8409
GenBank Accession LN501652 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>35-K020436-022-278-H02C-8409
AGATTTCCCGGACATGAAGCCATTTACAATAGATTATACGATACTCGTGAGACTGGATTC
ATTGAACCGGAGGAGGTACGTATGTAAACTTTGTCTCAAAAAAAAGAAAAAGTCATGATT
AATTATATTTGACGGTTTTCCTCGACTTGGAGAAATCTATAGGTGAAAGAGATGATAATA
GACGTTCTAGAGGAATCAGAACTTATGCTATCCGAGAGTATCATTGATTCTATCGTGTCT
AAGGTGTGTATAACGCTTAAGTTTATGAGCTTGATTTAACATTATAGTGATTTTACTTAC
TATTTTTGTTTACTTATATTTGGCAAAGACATTTGAAGAGGCCGATTGGAAAAAAGATGG
GATAATAGATTTGGAAGAATGGGAGAATTTTGTTGCCACCTATCCTTTGACACTAAAGAA
CATGACTATCCCTTTCTTGAAGTAATTCGTTTGTTTGTTTT
   
Sequence Name 36-K020436-022-278-H02C-JK12
GenBank Accession LN502050 [GenBank]
Sequencing primer gene specific primer, JK12: 5'-ATGGTTAGGAAAAACAAACAAACG-3'
Sequence (A. th genome BLAST matches underlined)
>36-K020436-022-278-H02C-JK12
TCAAGAAAGGGATAGTCATGTTCTTTAGTGTCAAAGGATAGGTGGCAACAAAATTCTCCC
ATTCTTCCAAATCTATTATCCCATCTTTTTTCCAATCGGCCTCTTCAAATGTCTTTGCCA
AATATAAGTAAACAAAAATAGTAAGTAAAATCACTATAATGTTAAATCAAGCTCATAAAC
TTAAGCGTTATACACACCTTAGACACGATAGAATCAATGATACTCTCGGATAGCATAAGT
TCTGATTCCTCTAGAACGTCTATTATCATCTCTTTCACCTATAGATTTCTCCAAGTCGAG
GAAAACCGTCAAATATAATTAATCATGACTTTTTCTTTTTTTTGAGACAAAGTTTACATA
CGTACCTCCTCCGGTTCAATGAATCCAGTCTCACGAGTATCGTATAATCTATTGTAAATG
GCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAA
AAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATT
ATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGA
AAGCAATAAACAAATTATTCTAATTCGGAAATCT

Last Updated on 07.07.2016 14:16