SimpleSearch - Line and FST details


Line specific information

 
Line ID 278H02
Vector Used pAC161
Line Availability only available from NASC (N426678)
Segregation Analysis 100:83:62
Confirmed for Hit At4g01420
Parent of DUPLO pair none
Parent of pair(s) 5684, 5742, 10993, 75770

Gene hit At4g01420

 
Sequence (A. th genome BLAST matches underlined)
>16-K015156-022-278-H02-8409
ACTGTACTACTTTGTGCTAAAAAAAAGAAAAAGTCATGATTAATTACTATTTGACGGTTT
TCCTCGACTTGGAGAAATCTATAGGTGAAAGAGATGATCATTGACGTCCTATGGGATCCT
CCCTTNACTGAGATCGGCCTGCTCTCTTTGCCTTAACTCTCCTGATGGTGCTGGGCCGAG
GTTTCCCTCTGTTTTCGGATCTGCCACTGCTTACGCCTACCAACACCGTTGCACTATCCT
TGAGAATCTGACTCCTGTGGGTATCCTAGCTATAGTGCGGNTCGGCGAGGCCCACTCATA
AGCTGCCTCGGGGCCCTCCGTGAGGGGTTCTGCCTGTTGGGACTACCCATAACACGTCCT
CTGGACAACCGGAAGCTGACACCCTTTGTGATCCTGCCTCTGGTGACTCATCCCTCCGGG
ATCCTCCCTATAGCGAGCTCGCTGAGACATCCACCACCCCAAAACCCGAAGATCTCAATG
GACCAATATC
GenBank Accession AL944022 [GenBank]
Graphic View Graphic view of gene At4g01420
Predicted Position of Insertion Chr4:580702 - go to primer design
BLAST e Value 5e-25
Hit Clone Code (BAC ID) F3D13
Hit Gene Code At4g01420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation calcineurin B-like protein 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL944022 [GenBank]


Last Updated on 31.08.2016 09:40