Sequences from confirmation amplicon


Confirmation sequences for line 279D09 and hit At3g58570 are shown.
Line ID 279D09
Locus At3g58570 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:21657029
Primers used for PCR NK02 - 8474, show primer details
   
Sequence Name 30-K102590-0022-279-D09C-8409
GenBank Accession LN499665 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>30-K102590-0022-279-D09C-8409
TGAGCCATTACATTGAATATATCGTAATAAATATCAGTTCGAACAAGTTCGTTTTCCATA
AATAAGTTGCAGCTATGCATGTAAGAAATGAGAGAAAGAGTCAACAAATCCAAATACTAA
AAATGAAGAACAAATGCAAATCGATTCGAGAGAAGTAGTTATCTGTAGAAGAATCTTCAA
AAAACCTCAGCTAATCGAATAATCTAAGAAATAGAAACGACTCGTAGTAACAAAACAAAA
TCACGATGAAGTAACACAAAGCTGAGAAGAATCGTTCCCTAAAACGAACAAATGCACAAA
TCATTAAACCCTAGAAGCAA
   
Sequence Name 30-K102591-0022-279-D09C-NK02
GenBank Accession LN499666 [GenBank]
Sequencing primer gene specific primer, NK02: 5'-GTTCGATTTCATTTTGCTTCTAGG-3'
Sequence (A. th genome BLAST matches underlined)
>30-K102591-0022-279-D09C-NK02
TTTAGGGACGATTCTTCTCAGCTTTGTGTACTTCATCGTGATTTTGTTTTGTTACTACGA
GTCGTTTCTATTTCTTAGATTATTCGATTAGCTGAGGTTTTTTGAAGATTCTTCTACAGA
TAACTACTTCTCTCGAATCGATTTGCATTTGTTCTTCATTTTTAGTATTTGGATTTGTTG
ACTCTTTCTCTCATTTCTTACATGCATAGCTGCAACTTATTTATGGAAAACGAACTTGTT
CGAACTGATATTTATTACGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTAC
ATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTT
TTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGA
TAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTA
ATTCGGAAATCTTTATTTCGACGTGTCTACATTCACGTCCAAATGGG

Last Updated on 07.07.2016 14:16