SimpleSearch - Line and FST details


Line specific information

 
Line ID 279D09
Vector Used pAC161
Line Availability only available from NASC (N426733)
Segregation Analysis 50:46:34
Confirmed for Hit At3g58570
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g58570

 
Sequence (A. th genome BLAST matches underlined)
>68-K015175-022-279-D09-8409
TTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAATTGAATATATCCGTATACT
TATAGAGCTGAACAGGTACGGTATGACCATATTAGCATCTGCTGGTATGCTTGTTATAAA
GGAGAGAAAGAGTCAACAAATCCAAATACTAAAAATGAAGAACAAATGCAAATCGATTCG
AGAGAAGTAGTTATCTGTAGAAGAATCTTCAAAAAACCTCAGCTAATCGAATAATCTAAG
AAATAGAAACGACTCGTAGTAACAAAACAAAATCACGATGAAGTAACACAAAGCTGAGAA
GAATCGTTCCCTAAAACGAACAAATGCACAAATCATTAAACCCTATGGGATCCTC
GenBank Accession AL944094 [GenBank]
Graphic View Graphic view of gene At3g58570
Predicted Position of Insertion Chr3:21657021 - go to primer design
BLAST e Value 2e-123
Hit Clone Code (BAC ID) F14P22
Hit Gene Code At3g58570 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation P-loop containing nucleoside triphosphate hydrolases superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g59480

 
Sequence (A. th genome BLAST matches underlined)
>68-K015123-022-279-D09-8409
NTGATCCATGTAGATTNTCCCGGGACATGAAGCCTTTACAATTGAATATATCCATATACT
CATTGAGCTCGATCGGGACGGAGGAGCATATCGGCGCTACTGGGATCCTCCCTATAGCGA
GGACAGTGACACTAGT
GenBank Accession AL944093 [GenBank]
Graphic View Graphic view of gene At3g59480
Predicted Position of Insertion Chr3:21983489 - go to primer design
BLAST e Value 3e-05
Hit Clone Code (BAC ID) F25L23
Hit Gene Code At3g59480 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation pfkB-like carbohydrate kinase family protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 31.08.2016 09:40