Sequences from confirmation amplicon


Confirmation sequences for line 279G06 and hit At5g61980 are shown.
Line ID 279G06
Locus At5g61980 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:24897129
Primers used for PCR HF04 - 8474, show primer details
   
Sequence Name 41-K023624-022-279-G06C-8409
GenBank Accession LN503931 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>41-K023624-022-279-G06C-8409
CCATATTCCTGTGAACAACAGAGCGACTTCCATTTCCCTGATACATAGAGCTTCAAAGAT
TCAGTAAAGATACAGTACATCACCAATCTGATCTATATATGTTTTCTCAAGGAAGGATCA
AAAACACAATTGTTTTTGGTTTTGCAACTTACTGAAGACCAATTCCATGGCTTGCGGTAA
TAGTATAGCATCCCACGGCTATCAAGGATAAAGAATCTTCTTTTCCAGTCACCTCTCAAG
TTTGAGGAACGTTTAGACAGATACCCTTGTCTGATAGTCTGAACCTGAAGAACAGTTATA
TCAACAGATAAATATAAAACAAGAGAGTATAAAGATGTGACAGCAGTTTGACGAGTAAGC
CTCAATACAAAAGATATTTCCTTACCTTTCCTTTTGCAGCAGATTGCATCACGGCCTCGA
TGACTTTCTGGGAGTTTCTTGAGTTATGTCTCATGCCATCCCCTGTTGGAGAAACACAGG
AGTTTCTAGTTTCACGATCAACTTGCCTTTGGTATTCCTGCATCCTTTCATTAAGTGATG
CCATCTCATAGTTTGCACATTCTCTA
   
Sequence Name 42-K023624-022-279-G06C-HF04
GenBank Accession LN504319 [GenBank]
Sequencing primer gene specific primer, HF04: 5'-GCTTATGCACACCAGTCTAGAGAA-3'
Sequence (A. th genome BLAST matches underlined)
>42-K023624-022-279-G06C-HF04
GCAAACTATGAGATGGCATCACTTAATGAAAGGATGCAGGAATACCAAAGGCAAGTTGAT
CGTGAAACTAGAAACTCCTGTGTTTCTCCAACAGGGGATGGCATGAGACATAACTCAAGA
AACTCCCAGAAAGTCATCGAGGCCGTGATGCAATCTGCTGCAAAAGGAAAGGTAAGGAAA
TATCTTTTGTATTGAGGCTTACTCGTCAAACTGCTGTCACATCTTTATACTCTCTTGTTT
TATATTTATCTGTTGATATAACTGTTCTTCAGGTTCAGACTATCAGACAAGGGTATCTGT
CTAAACGTTCCTCAAACTTGAGAGGTGACTGGAAAAGAAGATTCTTTATCCTTGATAGCC
GTGGGATGCTATACTATTACCGCAAGCCATGGAATTGGTCTTCAGTAAGTTGCAAAACCA
AAAACAATTGTGTTTTTGATCCTTCCTTGAGAAAACATATATAGATCAGATTGGTGATGT
ACTGTATCTTTACTGAATCTTTGAAGCTCTATGTATCAGGNAAATGGAAGTCGCTCTGTT
GTT

Last Updated on 23.10.2014 13:25