SimpleSearch - Line and FST details


Line specific information

 
Line ID 279G06
Vector Used pAC161
Line Availability only available from NASC (N426766)
Segregation Analysis 50:48:36
Confirmed for Hit At5g61980
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g61980

 
Sequence (A. th genome BLAST matches underlined)
>47-K015123-022-279-G06-8409
TATTCCTGTGAACAACAGAAGCGACTTCCATTTCCCTGATACATAGAGCTTCAAAGATTC
AGTAAAGATACAGTACATCACCAATCTGATCTATATATGTTTTCTCAAGGAAGGATCAAA
AACACAATTGTTTTTGGTTTTGCAACTTACTGAAGACCAATTCCATGGCTTGCGGTAATA
GTATAGCATCCCACGGCTATCAAGGATAAAGAATCTTCTTTTCCAGTCACCTCTCAAGTT
TGAGGAACGTTTAGACAGATACCCTTGTCTGATAGTCTGAACCTGAAGAACAGTTATATC
AACAGATAAATATAAAACAAGAGAGTATAAAGATGTGACAGCAGTTTGACGAGTAAGCCT
CAATACAAAAGATATTTCCTTACCTTTCCTTTTGCAGCAGATTGCATCACGGCCTCGATG
ACTTTCTGGGAGTTTCTTGAGTTATGTCTCATGCCATCCCCTGTTGGAGAAACACAGGAG
TTTCTATGGGATC
GenBank Accession AL944129 [GenBank]
Graphic View Graphic view of gene At5g61980
Predicted Position of Insertion Chr5:24897126 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) K22G18
Hit Gene Code At5g61980 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ARF-GAP domain 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL944130 [GenBank]


Last Updated on 31.08.2016 09:40