Sequences from confirmation amplicon


Confirmation sequences for line 281F10 and hit At4g11270 are shown.
Line ID 281F10
Locus At4g11270 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:6854438
Primers used for PCR JP01 - 8474, show primer details
   
Sequence Name 23-K019547-0022-281-F10C-8409
GenBank Accession LN496367 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>23-K019547-0022-281-F10C-8409
ATTTCCCGGACATGAAGCCATTTACAATTGCATCGACCGAGTCAGTGAACGAGTCGGGGT
GAGAGAAGAAGGAAGAACGAACTGGTAAACGACGTCGTAACAGTAATCACGACAAATATA
TCTGTACATATTTAGATGGATTTTTCGAGGTTGCAAATAAATTTTTTAAGGTAAATATTT
GGCAAAAGTTTGATAATTGATATTTTAACTTTACTAGATTATTATCAACTTAAAATACTT
AAATCTGTGTATTGGACGACGGGTCCTAATCTAGTCAATATATAAATTATAACTTGTTAA
AATATATCATAGTCTAAATTCACAAATCACATTGTATTTGCTAAACTATGAGTAAACGAT
TACGATATAAACAAAATGAGTAGAAAATGATTATTTTAAATTATTGTAGTTCTCTATAAA
TATCTTTACCATTAGTTTTCTTTCCTTTTTTCAGTATTATTCTTTTGTCAACTAATTTAT
TTGTTAAAAAATCTGGACTTATCAAGAATCAATCTTATGTTAAAAAATAAAATCAAAAGG
AAATTAGAAAATAAAATAAAATCTAATTACCTTTTTGTTTTTGGTTATATGACCTAGTAG
AGGTATTAAAACGTTCTTAAAAGAAAAAAAAAATCCCAAACACAGCAAAAAAAAAAAACC
CCT
   
Sequence Name 22-K019547-0022-281-F10C-JP01
GenBank Accession queueing for submission to ENA/GenBank
Sequencing primer gene specific primer, JP01: 5'-ACCGATTCTATTCCTCTAGGCTTT-3'
Sequence (A. th genome BLAST matches underlined)
>22-K019547-0022-281-F10C-JP01
TTTTTTGCGGGGTTGGGGATTTTTTTTTTCTTTAAAAAACGTTTAAAACCCCCAACAGGG
GCATAAACCCAAAAACAAAAGGGGAATAAAATTTTATTTTTTTTCCAAATTCCCTTTGGA
TTTTATTTTTAAACAAAAAATGGATTCTGGAAAAGCCCAAATTTTTTAACAAAAAAATTA
GTGGCCAAAAAAAAAATCCGGAAAAAGGGAAAAAAACCTAGGGGGAAAAATTTTTTTAGA
AACCCCCAAAATTTTAAAAAAACCTTTTCCCCCCCTTTTGGTTAAAACCGAAACCGTTAC
CCCAAAGTTAACCAAAAACAGGGGGTTTGGGGAATTTAAACTAGGAAATTTTTTACCAGG
TTAAAATTTATATTTGGCCAAAATAGGGCCCCGCCGCCCAAAACCCAAATTAAAGTTTTT
AAGGGGGAAAAAAACCTAGAAAGGTAAAAATACCATTTTCCAACCTTTGGCCAAATTTTT
CCCTAAAAAAATTTTTTGGCACCCCCAAAAAACCCCCCAAAATAGGCCCAAAAATATTGG
CCGGGATAACGGTAACAACGCCTTTAACCAGTTGGTTTTTCTTTTTTTTCCCCCCCCAAC

Last Updated on 07.07.2016 14:16