SimpleSearch - Line and FST details


Line specific information

 
Line ID 281F10
Vector Used pAC161
Line Availability only available from NASC (N426950)
Segregation Analysis 76:76:68
Confirmed for Hit At4g11270
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F15L11

 
Sequence (A. th genome BLAST matches underlined)
>78-K015199-022-281-F10-8409
NTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATATATCCTGGATCA
GCAATATATCCTAAATATATTTCCATGCTTTATTAAGTTTTTATTTAAAAGTTTCTTTTC
ATCATTTTACACATATAAGACCATAATTTTCTATAGCATTTTACCTTACCATGGTTTACT
ATTTTTTTTTTTTTTCCTTTAAAAAACCTTTTTACTTTAAAAAGGGGGAATGGGGGGGGC
CCAAAAGGGGGGGGGAAAAGGGGCCGGGAGGGACCCTTCCCCCAAAAATGGCGAACCCCC
CCGGGGGGGTAACCTGGGGGGCCCCCCTTTGGGGGGG
GenBank Accession AL944388 [GenBank]
Graphic View Graphic view of sequence AL944388 of line 281F10
Predicted Position of Insertion Chr2:1827871 - go to primer design
BLAST e Value 5e-53
Hit Clone Code (BAC ID) F15L11
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At4g11270

 
Sequence (A. th genome BLAST matches underlined)
>78-K015201-022-281-F10-8409
TGATCCATGTAGATTTCCCGGACTGAAGCACTTTACAATTGCTACTACCGTAGTATATGA
ACTAATCGCGTGAGTGATATAACAATGAAGAACTGAACTGTGTTATCACGTACGTAACAT
TAATCACTGACAATATATCTGTACATATTTAGATGAGTATTTTTCGAGGCTTGCAAATGG
ATTACTATAAGGTAAATATTTTGGCAAAAGTTTGATAATTGATATTTTAACTTTACTATG
GGATCCTCCCTAAAGAGAGACGGAAAACGGCCTATGGGATCCTCCCTCCCCAAAGATTGA
AAACCCCCGGGGTTTTTTAATTTTTTTTTCGCCCCATTTTTTTTGGGGGGGGGGGTTCAC
CCTGAAAACCGGCGGGGGAAAAGCCTT
GenBank Accession CR396434 [GenBank]
Graphic View Graphic view of gene At4g11270
Predicted Position of Insertion Chr4:6854426 - go to primer design
BLAST e Value 8e-21
Hit Clone Code (BAC ID) F8L21
Hit Gene Code At4g11270 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transducin/WD40 repeat-like superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03