Sequences from confirmation amplicon


Confirmation sequences for line 282A11 and hit At5g43650 are shown.
Line ID 282A11
Locus At5g43650 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:17533374
Primers used for PCR MJ17 - 8474, show primer details
   
Sequence Name 07-K023017-022-232-A11C-8409
GenBank Accession LN489078 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>07-K023017-022-232-A11C-8409
CATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAAGCTTCTTTCCACTCTCTTTTC
AACCTCCTCTCCTCTAATCTGCCAAAAAGTTAACTTTAAATTTAATATCATCACACTAAT
ACAGATCTAACTACTTAATTAAAAAAACATACAACCATCTACTTTTTTTTTGCTACTAAC
ACAAAACAACCTACCTATTATTACCTTTATGTACTTGTCAAGTTGTCATAACCAAAGAGA
AACCAAAACCGGATTCAACCAATTCGAATCGAATTAAATATGTACCTGAGTCTCGATGGT
CATGGTCGCAGAAAACTCTTGAGGAGAGAAATTGGCATGGACTGTTTTCAGTTTTGTTCC
CATTGATTTAAGATAATGAAGCGCTTCAAGCATTGAATCTAGTCCAGACAAAGGTTCTTT
TAGATTAACCCTAACCTTTGTTTCAC
   
Sequence Name 08-K023017-022-232-A11C-MJ17
GenBank Accession LN489544 [GenBank]
Sequencing primer gene specific primer, MJ17: 5'-TGATGAAATGAGTGAAACAAAGGT-3'
Sequence (A. th genome BLAST matches underlined)
>08-K023017-022-232-A11C-MJ17
GTTAATCTAAAAGAACCTTTGTCTGGACTAGATTCAATGCTTGAAGCGCTTCATTATCTT
AAATCAATGGGAACAAAACTGAAAACAGTCCATGCCAATTTCTCTCCTCAAGAGTTTTCT
GCGACCATGACCATCGAGACTCAGGTACATATTTAATTCGATTCGAATTGGTTGAATCCG
GTTTTGGTTTCTCTTTGGTTATGACAACTTGACAAGTACATAAAGGTAATAATAGGTAGG
TTGTTTTGTGTTAGTAGCAAAAAAAAAGTAGATGGTTGTATGTTTTTTTAATTAAGTAGT
TAGATCTGTATTAGTGTGATGATATTAAATTTAAAGTTAACTTTTTGGCAGATTAGAGGA
GAGGAGGTTGAAAAGAGAGTGGAAAGAAGCTTCAATTGTAAATGGCTTCATGTCCGGGAA
ATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTAC
CAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACA
TTTTGATAAAACGACAAATTACGATCCGTCGTATTTATGGGCGAAAGCAATAAACAAATT
ATTCTAATTCGGAAATCTTTATTTCGA

Last Updated on 23.10.2014 13:25