SimpleSearch - Line and FST details


Line specific information

 
Line ID 282A11
Vector Used pAC161
Line Availability only available from NASC (N426987)
Segregation Analysis 100:81:77
Confirmed for Hit At5g43650
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g43650

 
Sequence (A. th genome BLAST matches underlined)
>81-K015177-022-282-A11-8409
TTGATCCATTGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATACTATTTTGCGCT
ATGTTATCCTCCTTATATTGAGTAATACTGCCAAAAAGTTAACTTTAAATTTAATATCAT
CACACTAATACAGATCTAACTACTTAATTAAAAAAACATACAACCATCTACTTTTTTTTT
GCTACTAACACAAAACAACCTACCTATTATTACCTTTATGTACTTGTCAAGTTGTCATAA
CCAAAGAGAAACCAAAACCGGATTCAACCAATTCGAATCGAATTAAATATGTACCTGAGT
CTCGATGGTCATGGTCGCAAAAAACTCTTGAGGAGAGAAATTGGCATGGACTGTTTTCAG
TTTTGTTCCCATTGATTTAAGATAATGAAGCGCTTCAAGCATTGAATCTATGGGATCCTC
C
GenBank Accession AL944434 [GenBank]
Graphic View Graphic view of gene At5g43650
Predicted Position of Insertion Chr5:17533383 - go to primer design
BLAST e Value 2e-151
Hit Clone Code (BAC ID) K9D7
Hit Gene Code At5g43650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit T6J22

 
Sequence (A. th genome BLAST matches underlined)
>81-K015202-022-282-A11-8409
CTGATCCATGTAGATTTACCCGGACATGAANGCCTTTACAATTGAATATACCAACAAACT
TAAAAATAAAAATCTCTTTGGTCTTTGTTATTTTTTATTTGTTCAACTAACAGAAATGAT
AAGACACATCTTTAGATAATGTTTATGTCTTCTTTTATTAATTGTCTTTTTGTGTTCGTC
CCAACGAAACTTAATATATAACCAATAATGATCTGAAAATGATTTTTAAGAGTGGTTAAA
AATGTAGTTAGATTAATAGCTTTAAAAAAATGTATTTCCTCTTTAATTTATTAATTGAAC
CCTTTATTTAAATATAAAAATCAATTAAAACCATTTTATTAAAAATAAGTGCTTACACCT
GTCATTAAAAATAATTGCGTGAAACCGTCCAATACACTATTTAGACTATAAACTTAGCCA
TAATGGCCCTATGGGATCCTCCCTATAGTGAGACCAAAAA
GenBank Accession AL944435 [GenBank]
Graphic View Graphic view of sequence AL944435 of line 282A11
Predicted Position of Insertion Chr3:11971733 - go to primer design
BLAST e Value 1e-111
Hit Clone Code (BAC ID) T6J22
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 31.08.2016 09:40