Sequences from confirmation amplicon


Confirmation sequences for line 284B09 and hit At1g18880 are shown.
Line ID 284B09
Locus At1g18880 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:6521697
Primers used for PCR YW01 - 8474, show primer details
   
Sequence Name 03-K024601-022-284-B09C-8409
GenBank Accession LN487319 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>03-K024601-022-284-B09C-8409
GTATCGTTGCTTGCGTTTGATGCAAAGGGTTCGGTGGCAATGGATCTAACGGCTGTGATT
CATCCCCTGCATCCAGCTCAATGCGCTAAGGAAATAGGAAGCGTGTGCAATGGGCCATCC
ATCGGACAAATCATGTTTCTCGCCGGAGCAATGGTTTTGCTGGTGATCGGAGCCGGTGGG
ATTAGGCCATGCAATCTTCCATTTGGTGCTGATCAGTTCGATCCGAAGACAAAAGAAGGG
AAACGAGGGATTGAGAGTTTCTTCAATTGGTATTTCTTCACCTTCACGTTTGCTCAGATG
GTGTCGTTAACCCTCATCGTCTATGTTCAGTCAAACGTGAGCTGGAGCATTGGTTTAGCC
ATCCCAGCTATTC
   
Sequence Name 04-K024601-022-284-B09C-YW01
GenBank Accession LN487758 [GenBank]
Sequencing primer gene specific primer, YW01: 5'-CCAAGTAGCATTAGAATAGCTGGG-3'
Sequence (A. th genome BLAST matches underlined)
>04-K024601-022-284-B09C-YW01
TAAACCAATGCTCCAGCTCACGTTTGACTGAACATAGACGATGAGGGTTAACGACACCAT
CTGAGCAAACGTGAAGGTGAAGAAATACCAATTGAAGAAACTCTCAATCCCTCGTTTCCC
TTCTTTTGTCTTCGGATCGAACTGATCAGCACCAAATGGAAGATTGCATGGCCTAATCCC
ACCGGCTCCGATCACCAGCAAAACCATTGCTCCGGCGAGAAACATGATTTGTCCGATGGA
TGGCCCATTGCACACGCTTCCTATTTCCTTAGCGCATTGAGCTGGATGCAGGGGATGAAT
CACAGCCGTTAGATCCATTGCCACCGAACCCTTTGCATCAAACACAACAAACGATACCAC
AGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCA
ATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACG
ACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGA
AATCTTTATTTCGACGTGTCTACA

Last Updated on 23.10.2014 13:25