SimpleSearch - Line and FST details


Line specific information

 
Line ID 284B09
Vector Used pAC161
Line Availability only available from NASC (N427189)
Segregation Analysis 50:46:43
Confirmed for Hit At1g18880 At1g66930
Parent of DUPLO pair none
Parent of pair(s) 4405, 7371, 8162, 97107

Gene hit At1g18880

 
Sequence (A. th genome BLAST matches underlined)
>66-K015276-022-284-B09-8409
NTGATCCATGTAGATGTTCCCGGACATGAAGCACTTGCCACGATTGAAACTTTCAGACAT
AATCACGCCTGTGGGATCCTCCATATAGTGAGTCCTCCGTATAGTGAGGCGTGTGCAATG
GGCCATCCATCGGACAAATCATGTTTCTCGCCGGAGCAATGGTTTTGCTGGTGATCGGAG
CCGGTGGGATTAGGCCATGCAATCTTCCATTTGGTGCTGATCAGTTCGATCCGAAGACAA
AAGAAGGGAAACGAGGGATTGAGAGTTTCTTCAATTGGTATTTCTTCACCTTCACGTTTG
CTCAGATGGTGTCGTTAACCCTCATCGTCTATGTTCAGTCAAACGTGAGCTGGAGCATTG
GTTTAGCCATCCCAGCTATTCTAATGCTACTTGGTTGCATCATATTCTTCGCTGGTTCTA
AGCTCTATGTCAAGGTTAAAGCTATGGGATCCTCC
GenBank Accession AL944710 [GenBank]
Graphic View Graphic view of gene At1g18880
Predicted Position of Insertion Chr1:6521733 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F6A14
Hit Gene Code At1g18880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Major facilitator superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g66930

 
Sequence (A. th genome BLAST matches underlined)
>66-K015289-022-284-B09-8409
NTGATCCATGTAGATTNTCCCGGACATGAAGCACTATTTCACTTGAATATTTTCTAGTCG
CTTGGGCCTTGAGGAAACTTACCACTATGGGACACTATGATTCAATCTGTCTCTGTTGTT
GACGAATTCTCTGTCTTAAAGTCAATATGATGCTCTTTGTGATCCCATTTTTGATTTATG
TATCTGCTGATGAGCTTATGCGCCGCTGAAGTGAACGGATAAGCTGCTGCAATCATAGAA
ATCTCTATTACCCCTTTTGGATACCTGGTCGAGAATATTGTGGCCACCCTGACTTCAAGC
TTGACTGTGGCGGAGGATTCGCAGAGCTTAACATATCCTACGTGAATTTCAGAATCTTAA
ATATGAGTTATGACTCTTCTAACAAAAGACTTGCCAGATCAGACTATCTCAACGATCTTT
GTCCCCCAAACCCACTAAATGATGAGCCTCTCATCGAAACAGTCCTTCAATTCAGTGCTG
ACACAGAGTTGCTAACATTATATTACGACTGCCAACTTAATTCATCTGCTACTTCTCCTT
TTCCTATGGGATCCTCCCTTAGGG
GenBank Accession AL944711 [GenBank]
Graphic View Graphic view of gene At1g66930
Predicted Position of Insertion Chr1:24970736 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T4O24
Hit Gene Code At1g66930 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03