Sequences from confirmation amplicon


Confirmation sequences for line 291G05 and hit At2g22190 are shown.
Line ID 291G05
Locus At2g22190 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:9433935
Primers used for PCR MK70 - 8474, show primer details
   
Sequence Name 87-K101329-0022-291-G05C-8409
GenBank Accession LN514739 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>87-K101329-0022-291-G05C-8409
CCATTTACCATTATTTCCATAACCTATAAAACGTAGAAAATAAGAGACTTTTTTTTATAA
GAAATCTACATCAAAAACAAAAATTCACCAGTTTGACAAAAAAACAAACATAAATTCACC
TTAGTACACTAAAACATTATGTGTTGTGTATATAGAGTGACAAAAGATTACCTCATCTGG
CTCTTGCAAAGAATAAGAAGCATTAGTCTCCTTTGCGTATTTGGACACAAGAATTCCAAG
ACCTTGTTTTTTGTCTCTCAGTATCTGTTACAATGTCACTTTAATCAGTATTTATATAAT
CATTAATCTATACTATTTATATATGTTAATTTAACGAGACATTATGAATATAGAATATGT
GTATCAGTGTATACCTTAAAGGCGTCTTCGTCGGTACGATCATCTCCNATATATATAGGA
AAAACATCGGTACAATTATCATATCCTACACATGGTATAAATGTTAATTTCCATTAGTGA
AAACTAATTAGAAATTTCAACTTTTAAAATCAAAACCAAAACCAAAAGTAATGTAATGTA
AGCCACCATTATATGTAATTTTATTATGATCAATATATTGATAATTGGGAATGAATCAGA
TT
   
Sequence Name 87-K101335-0022-291-G05C-MK70
GenBank Accession LN514740 [GenBank]
Sequencing primer gene specific primer, MK70: 5'-AGGTAAATCTTGATTCATTCCCAA-3'
Sequence (A. th genome BLAST matches underlined)
>87-K101335-0022-291-G05C-MK70
ATAATTACTAAATGGTGGCTTACATTACATTACTTTTGGTTTTGGTTTTGATTTTAAAAG
TTGAAATTTCTAATTAGTTTTCACTAATCGAAATTAACATTTATACCATGTGTAGGATAT
GATAATTGTACCGATGTTTTTCCTATATATATTGGAGATGATCGTACCGACGAAGACGCC
TTTAAGGTATACACTGATACACATATTCTATATTCATAATGTCTCGTTAAATTAACATAT
ATNAATAGTATAGATTAATGATTATATAAATACTGATTAAAGTGACATTGTAACAGATAC
TGAGAGACAAAAAACAAGGTCTTGGAATTCTTGTGTCCAAATACGCANAGGAGACTAATG
CTTCTTATTCTTTGCAAGAGCCAGATGAGGTAATCTTTTGTCACTCTATATACACAACAC
ATAATGTTTTAGTGTACTAAGGTGAATTTATGTTTGTTTTTTTGTTCAACTGGTGAATTT
TTGTTTTTGATGTAGATTTCTTATAAAAAAAAGTCTCTTATTTTCTACGTTTTATAGGTT
ATGGAAATAATGTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTA
TGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATG
TAG
Primers used for PCR MK71 - 8474, show primer details
   
Sequence Name 90-K101329-0022-291-G05C-OriL
GenBank Accession LN515023 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>90-K101329-0022-291-G05C-OriL
GAGCCGTTTGGTGGATGGAAACGTCAAGGTGTGGGGCATGAAGAGTTTACAAGTACAGGA
GAAACTTGTTCTTTTTCTTTTTTCTTTTTACTATGTAGTATTGGTAAAGATTCTAACGTA
TAAGAGAACGAGAATAAGTTTATTAATATAACAAGAAGACAAATATTGAGGTTCATGTTC
CTTTTATTAAACTTTGGTTTTCTGACTAGTCGTTTGTTGCTATCCATGCAATGTTCAAAT
TTTAAATTATCCCATGTATAAAAATTCCTTGTATTTTTGAAATAAAAACAAAGATATACA
ATAATGAGGATTTTTGNAAAATATCACAACCAANAGAGATGTATTCAATCTAAGATTTTA
AGTTATTTACTAGA
   
Sequence Name 90-K101335-0022-291-G05C-MK71
GenBank Accession LN515024 [GenBank]
Sequencing primer gene specific primer, MK71: 5'-TACCGCGGGTTAAAATCTAGTAAA-3'
Sequence (A. th genome BLAST matches underlined)
>90-K101335-0022-291-G05C-MK71
AATTGATACTCTCTTTTGGTTGTGATATTTTTCAAAATCCTCATTATTGTATATCTTTGT
TTTTATTTCAAAAATACAAGGAATTTTTATACATGGGATAATTTAAAATTTGAACATTGC
ATGGATAGCAACAAACGACTAGTCAGAAAACCAAAGTTTAATAAAAGGAACATGAACCTC
AATATTTGTCTTCTTGTTATATTAATAAACTTATTCTCGTTCTCTTATACGTTAGAATCT
TTACCAATACTACATAGTAAAAAGAAAAAAGAAAAAGAACAAGTTTCTCCTGTACTTGTA
AACTCTTCATGCCCCACACCTTGACTGTTTCCATTCCACCAAACGGCTTCATGTCCGGGA
AATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTA
CCAATTTTTTTTTCATTTCAAAATGTAGATGTCCGC

Last Updated on 07.07.2016 14:16