SimpleSearch - Line and FST details


Line specific information

 
Line ID 291G05
Vector Used pAC161
Line Availability only available from NASC (N427917)
Segregation Analysis 50:48:45
Confirmed for Hit At2g22190
Parent of DUPLO pair none
Parent of pair(s) 8708, 93654, 93658, 93661, 93664, 93668, 93671, 93672, 93673

Gene hit At2g22190

 
Sequence (A. th genome BLAST matches underlined)
>39-K015354-022-291-G05-8409
NTGATCCATGTAGATTTCCCGGACATGAAGCCGTTTCACGTAATGGACACTATCCTATGT
GACGGGCATGAAGAGAGACCTTTTTCTAGAGAAACTCGACCTTTTACTCTATTCTTCCCA
CATGGACAATTGGCAAACATACTATCACCTTAATACCTAAAACATTATGTGTTGAGTATA
TGAAGACGACATATGGAGGCCTGAGCTGGCTCTATGAAACAATGGGAAGCTGACTACGGC
TTTGCGCATATGGACACAAGAATTCCAAGACCTTGTTTTTTGTCTCTCACTATCTGGTAC
AATGTCAGCTTTAATCAGTATTGATATAATCATTAATCTATACTATTTATATATGTTAAT
TTAACGAGACATTATGAATATAGAATATGTGTATCAGGGCATACCTTAAAGGCGTCTTCG
TCGGTACGATCATCTCCAATATATATAGGAAAAACATCGGTACAATTATCATATCCTACA
CATGGTATAAATGTTAATTTCGATTAGTGAAAACTAATTAGAAATTTCAACTTTTAAAAT
CAAAACCAAAACCAAAAGTAATGTAATGTAAGCCACCATTATATGTAATTTTATTATGAT
CAATATATTGATAATTGGGAATGAATCAAGATTTACCTATGGGATCC
GenBank Accession AL945770 [GenBank]
Graphic View Graphic view of gene At2g22190
Predicted Position of Insertion Chr2:9433960 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T26C19
Hit Gene Code At2g22190 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Haloacid dehalogenase-like hydrolase (HAD) superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL945769 [GenBank]


Last Updated on 14.10.2014 10:23