Sequences from confirmation amplicon


Confirmation sequences for line 292H03 and hit At4g14690 are shown.
Line ID 292H03
Locus At4g14690 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:8418526
Primers used for PCR DE26 - 8474, show primer details
   
Sequence Name 05-K021340-022-292-H03C-8409
GenBank Accession LN488167 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>05-K021340-022-292-H03C-8409
TAGATTTCCCGAGGTTAGTGTATATATACCTGAGCCATGCATCTGACTCCTACCGGAGCA
ATCCTCTTGAAGAAGAGTTGGTTTGTGTTTCTGATGTTGCGTGTAGTCAATACACCGGAA
GGAGCAGCGAACACTGACTGCATGTTAAACGACGCCGTTGCCATTTCTGATTAGGTTTTC
TAAAAGCCGAAGATCGATGAAGAAGAGAGAAATGAATAAATTATAAGACTTGAGAAGTGA
GATGGAGTTGGTTTGAGGTGTAACTGTAGGATTATCTCTTCATTTATAGAGTTGGTGAAG
GAAAATGATAGGCCCAGTATTTTCTGGATTTTATTTATCTTTACTGATTTATGGGATACT
ATGATTACTTATTTTATTTTTGTTTTTGTGTGGTGTGTAGTAGAGTAATAAATAAGTAGA
AAGAAATCTATCAAAGAAAAGAAAAAAACTGAATTCAAACTTTTTATTCCTTTTTTTTCT
TTTTTCCACTTTAAACTTTTTTTTTCTTTTGGGGAAGAAAAAGTTTCCTCAGAATAAATG
TTTTCAAACTTATGAGATTTTTTCCATATTTATTGTAACACCTAACAAA
   
Sequence Name 06-K021340-022-292-H03C-DE26
GenBank Accession LN488614 [GenBank]
Sequencing primer gene specific primer, DE26: 5'-TGACCAACTGATTTGTTAGGTGTT-3'
Sequence (A. th genome BLAST matches underlined)
>06-K021340-022-292-H03C-DE26
ATAAATATGGAAAAAATCTCATAAGTTTGAAAACATTTATTCTGAGGAAACTTTTTCTTC
CCCAAAAGAAAAAAAAAGTTTAAAGTGGAAAAAAGAAAAAAAAGGAATAAAAAGTTTGAA
TTCAGTTTTTTTCTTTTCTTTGATAGATTTCTTTCTACTTATTTATTACTCTACTACACA
CCACACAAAAACAAAAATAAAATAAGTAATCATAGTATCCCATAAATCAGTAAAGATAAA
TAAAATCCAGAAAATACTGGGCCTATCATTTTCCTTCACCAACTCTATAAATGAAGAGAT
AATCCTACAGTTACACCTCAAACCAACTCCATCTCACTTCTCAAGTCTTATAATTTATTC
ATTTCTCTCTTCTTCATCGATCTTCGGCTTTTAGAAAACCTAATCAGAAATGGCAACGGC
GTCGTTTAACATGCAGTCAGTGTTCGCTGCTCCTTCCGGTGTATTGACTACACGCAACAT
CAGAAACACAAACCAACTCTTCTTCAAGAGGATTGCTCCGGTAGGAGTCAGATGCATGGC
TCAGGTATATATACACTAACCTCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTC
AATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTC
CGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGT
ATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTT

Last Updated on 07.07.2016 14:16