SimpleSearch - Line and FST details


Line specific information

 
Line ID 292H03
Vector Used pAC161
Line Availability only available from NASC (N428023)
Segregation Analysis 100:100:61
Confirmed for Hit At4g14690
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g14690

Sequence (A. th genome BLAST matches underlined)
>24-K015437-022-292-H03-8409
NTGATCCATGTAGATTTCCCGAGGTTAGTGTATATATACCTGANGCCTGCATCTGACTCC
TACCGGAGCAATCCTCTTGAAGAAGAGTTGGTTTGTGTTTCTGATGTTGCGTGTAGTCAA
TACACCGGAAGGAGCAGCGAACACTGACTGCATGTTAAACGACGCCGTTGCCATTTCTGA
TTAGGTTTTCTAAAAGCCGAAGATCGATGAAGAAGAGAGAAATGAATAAATTATAAGACT
TGAGAAGTGAGATGGAGTTGGTTTGAGGTGTAACTGTAGGATTATCTCTTCATTTATAGA
GTTGGTGAAGGAAAATGATAGGCCCAGTATTTTCTGGATTTTATTTATCTTTACTGATTT
ATGGGATACTATGATTACTTATTTTATTTTTGTTTTTGTGTGGTGTGTACTAAAGTAATA
AATAAGTAGAAAGAAATCTATCACAGAAAAGAAAAAAACTGAATTCAAACTTTTTATTCC
TTTGTTTTCTTTTTTCCACTTTAAACTTTTTTTTTCTTTGGGGGAAAAAAAANGTTACTC
AGAATAAACGTTTTCAACCTTATGAGAGTTTTTCCATATTTATTGTACCACCTAACAAAT
CAG
GenBank Accession AL945928 [GenBank]
Graphic View Graphic view of gene At4g14690
Predicted Position of Insertion Chr4:8418526 - go to primer design
BLAST e Value 2e-166
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g14690 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Chlorophyll A-B binding family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Casazza et al. 2005, elip2-2]
Other FSTs Supporting this Hit AL945929 [GenBank]


Last Updated on 14.10.2014 10:23