Sequences from confirmation amplicon


Confirmation sequences for line 293D12 and hit At1g21410 are shown.
Line ID 293D12
Locus At1g21410 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:7498741
Primers used for PCR JD03 - 8474, show primer details
   
Sequence Name 33-K021644-022-293-D12C-8409
GenBank Accession LN500819 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>33-K021644-022-293-D12C-8409
GCCATTTACCCAAGTTTAGTGACTGCATCTGATTGCAGTTATTCCCAATAGCCTGCACAC
AACAACATGAACAAATTCTATCAACTCTGCCACACTTATGACCAAAGGAGTAAAACCAAG
TTTGGGAGAGAACATTAAAGAAAAACAAAGATTCACCTCCAAGGCATTGTCAGTTACAGC
TTTGACACATCCGCAAAGATTCAAAACTTTAAGCTTTCTGCAGAATCTGGTCAAATACGC
AATAGCAGTGTCGCTGAATGAAGTGCAGCCACTAAGGTTGAGTTTTGTGAGGTCTGGGCA
ACCATGAGCAAGTGCATAAAGTGAACGGTCTGTAATTTTCAAGCTTTTTGCT
   
Sequence Name 34-K021644-022-293-D12C-JD03
GenBank Accession LN501243 [GenBank]
Sequencing primer gene specific primer, JD03: 5'-CAGCAAAAGCTTGAAAATTACAGA-3'
Sequence (A. th genome BLAST matches underlined)
>34-K021644-022-293-D12C-JD03
TGGTTGCCAGACCTCACAAAACTCAACCTTAGTGGCTGCACTTCATTCAGCGACACTGCT
ATTGCGTATTTGACCAGATTCTGCAGAAAGCTTAAAGTTTTGAATCTTTGCGGATGTGTC
AAAGCTGTAACTGACAATGCCTTGGAGGTGAATCTTTGTTTTTCTTTAATGTTCTCTCCC
AAACTTGGTTTTACTCCTTTGGTCATAAGTGTGGCAGAGTTGATAGAATTTGTTCATGTT
GTTGTGTGCAGGCTATTGGGAATAACTGCAATCAGATGCAGTCACTAAACTTGGGGTAAA
TGGCTTAATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGA
AAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTA
TTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGC
GAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATT

Last Updated on 23.10.2014 13:25