SimpleSearch - Line and FST details


Line specific information

 
Line ID 293D12
Vector Used pAC161
Line Availability only available from NASC (N428080)
Segregation Analysis 100:93:74
Confirmed for Hit At1g21410
Parent of DUPLO pair 2560
Parent of pair(s) none

Gene hit At1g21410

 
Sequence (A. th genome BLAST matches underlined)
>92-K015438-022-293-D12-8409
CTGATCCATGTAGAATTTCCCGGACATTAAGCACTTTACCCCAAGTTTAGTGACTGCATG
TGATTGCAGTTATTCCCAATAGCCTGCACACAACAACATGAACAAATTCTATCAACTCTG
CCACACTTATGACCAAAGGAGTAAAACCAAGTTTGGGAGAGAACATTAAAGAAAAACAAA
GATTCACCTCCAAGGCATTGTCTGTTACAGCTTTGACACATCCGCAAAGATTCAAAACTT
TAAGCTTTCTGCAGAATCTGGTCAAATACGCAATAGCAGTGTCGCTGAATGAAGTGCAGC
CACTAAGGTTGAGTTTTGTGAGGTCTGGGCAACCATGAGCAAGTGCATAAAGTGAACGGT
CTGTAATTTTCAAGCTTTTGCTGAGATCAAGTTCTTGTAACTCATGGCAGTGATTTGCTA
TGGCCTCCACTGCATTGTCCTCTATGGGATCCT
GenBank Accession AL946016 [GenBank]
Graphic View Graphic view of gene At1g21410
Predicted Position of Insertion Chr1:7498741 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F24J8
Hit Gene Code At1g21410 [TAIR] [MIPS] [SIGnAL]
Gene Annotation F-box/RNI-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL946017 [GenBank]


Last Updated on 14.10.2014 10:23