Sequences from confirmation amplicon


Confirmation sequences for line 294A09 and hit At3g20330 are shown.
Line ID 294A09
Locus At3g20330 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:7091091
Primers used for PCR RZ15 - 8474, show primer details
   
Sequence Name 42-K018602-022-294-A09C-RZ15
GenBank Accession LN504297 [GenBank]
Sequencing primer gene specific primer, RZ15: 5'-ATGCTAAGCGCTATATTCGATGTT-3'
Sequence (A. th genome BLAST matches underlined)
>42-K018602-022-294-A09C-RZ15
AAATGGAAAAGATAGAAAAGAGCTCTTCACAAAGTGAAATCCTCAAGGGTTATTTAATGG
CTACCCTCTTTTATGAGCCTTCTACCCGTACCAGGCTTTCATTTGAATCTGCTATGAAAC
GCCTTGGAGGTGAAGTCTTAACTACTGAGAACGCTAGAGAGTTTTCGTCTGCCGCGAAAG
GGGAAACACTTGAAGGTACCATCTTAGCTAGTATCTCATTATTGCTGTGAAACATGTTGA
GTGTTAGATTATTTACGGAAATTTTTGGGGCATTTTTCAGACACAATAAGAACAGTGGAG
GGTTATTCAGATATAATTGTGATGCGACATTTTGAAAGCGGTGCTGCAAGAAAAGCTGCA
GCTACTGCCAATATACCTGTCATTAATGCAGGTGATGGTCCTGGAGAGCATCCTACTCAG
GTATGTTGTGTTCTTAACCTTTAGTTTTTTTCAATTGTCTTAAACAAACATTACTTTACA
TCCTTGTTTCTTATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCA
ATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTC
AAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAA
ATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTATAATTCGGAAATC
T
   
Sequence Name 43-K018602-022-294-A09C-8409
GenBank Accession LN504678 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>43-K018602-022-294-A09C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATAAGAAACAAGGATGTAAAGTAATG
TTTGTTTAAGACAATTGAAAAAAACTAAAGGTTAAGAACACAACATACCTGAGTAGGATG
CTCTCCAGGACCATCACCTGCATTAATGACAGGTATATTGGCAGTAGCTGCAGCTTTTCT
TGCAGCACCGCTTTCAAAATGTCGCATCACAATTATATCTGAATAACCCTCCACTGTTCT
TATTGTGTCTGAAAAATGCCCCAAAAATTTCCGTAAATAATCTAACACTCAACATGTTTC
ACAGCAATAATGAGATACTAGCTAAGATGGTACCTTCAAGTGTTTCCCCTTTCGCGGCAG
ACGAAAACTCTCTAGCGTTCTCAGTAGTTAAGACTTCACCTCCAAGGCGTTTCATAGCAG
ATTCAAATGAAAGCCTGGTACGGGTAGAAGGCTCATAAAAGAGGGTAGCCATTAAATAAC
CCTTGAGGATTTCACTTTGTGAAGAGCTCTTTTCTATCTTTTCCATTTCGCGTGCAACAT
CGAATATAG

Last Updated on 07.07.2016 14:16