SimpleSearch - Line and FST details


Line specific information

 
Line ID 294A09
Vector Used pAC161
Line Availability only available from NASC (N428137)
Segregation Analysis 100:99:65
Confirmed for Hit At3g20330
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g20330

 
Sequence (A. th genome BLAST matches underlined)
>65-K015439-022-294-A09-8409
NTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAATTGAATAAGAAACAAGGAT
GTAAAGTAATGTTTGTTTAAGACAATTGAAAAAAACAAAGGTTAAGAACACAACATACCT
GAGTAGGATGCTCTCCAGGACCATCACCTGCATTAATGACAGGTATATTGGCAGTAGCTG
CAGCTTTTCTTGCAGCACCGCTTTCAAAATGTCGCATCACAATTATATCTGAATAACCCT
CCACTGTTCTTATTGTGTCTGAAAAATGCCCCAAAAATTTCCGTAAATAATCTAACACTC
AACATGTTTCACAGCAATAATGAGATACTAGGGGATACTC
GenBank Accession BX942934 [GenBank]
Graphic View Graphic view of gene At3g20330
Predicted Position of Insertion Chr3:7091091 - go to primer design
BLAST e Value 2e-144
Hit Clone Code (BAC ID) MQC12
Hit Gene Code At3g20330 [TAIR] [MIPS] [SIGnAL]
Gene Annotation PYRIMIDINE B
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23