Sequences from confirmation amplicon


Confirmation sequences for line 295C05 and hit At3g11630 are shown.
Line ID 295C05
Locus At3g11630 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:3673487
Primers used for PCR NR58 - 8474, show primer details
   
Sequence Name 77-K102506-0022-295-C05C-8409
GenBank Accession LN513530 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>77-K102506-0022-295-C05C-8409
TCTCAAGTCGTTCGGAGTGCTCATCCATGATCAGGTAATTGTTAGCCTTTAAATCTTGGC
TACCTTCCTTTAAACTTTCGAAGTGTTTGGGATAAATGAAAACAAGAACTTTGTTTGTGT
AAGAACAGGGAATAGCACTGAGAGGACTTTTCATAATCGACAAGGAAGGAGTGATCCAAC
ATTCCACCATCAACAATCTTGGTATTGGCCGAAGCGTTGATGAGACAATGAGAACCCTCC
AGGTAAAGATACAAATAAATACACACAACTCCAAAAACCGCTCTTTCCTTTCACTCGATT
TCCGGTATGCTTAATACGTTTTCAATGTTGCAGGCATTACAGTACATCCAGGAAAACCCG
GATGAAGTCTGCCCAGCAGGATGGAAGCCGGGTGAGAAGTCAATGAAACCCGACCCAAAA
CTCA
   
Sequence Name 77-K102507-0022-295-C05C-NR58
GenBank Accession LN513531 [GenBank]
Sequencing primer gene specific primer, NR58: 5'-GTACTCTTTGCTGAGTTTTGGGTC-3'
Sequence (A. th genome BLAST matches underlined)
>77-K102507-0022-295-C05C-NR58
GCTTCATCCTGCTGGGCAGACTTCATCCGGGTTTTCCTGGATGTACTGTAATGCCTGCAA
CATTGAAAACGTATTAAGCATACCGGAAATCGAGTGAAAGGAAAGAGCGGTTTTTGGAGT
TGTGTGTATTTATTTGTATCTTTACCTGGAGGGTTCTCATTGTCTCATCAACGCTTCGGC
CAATACCAAGATTGTTGATGGTGGAATGTTGGATCACTCCTTCCTTGTCGATTATGAAAA
GTCCTCTCAGTGCTATTCCCTGTTCTTACACAAACAAAGTTCTTGTTTTCATTTATCCCA
AACACTTCGAAAGTTTAAAGGAAGGTAGCCAAGATTTAAAGGCTAACAATTACCTGATCA
TGGATGAGCACTCCGAACGACTTTGAGATTGATTTAGTGACAATTGGGAAATCTACATGG
ATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTT
TCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAA
ACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTC
GGAAATCTTTATTTCGACGTGTCTACATTCACTCCAAAATGG

Last Updated on 23.10.2014 13:25