SimpleSearch - Line and FST details


Line specific information

 
Line ID 295C05
Vector Used pAC161
Line Availability only available from NASC (N428253)
Segregation Analysis 50:44:38
Confirmed for Hit At3g11630
Parent of DUPLO pair 2259
Parent of pair(s) none

Gene hit At3g11630

 
Sequence (A. th genome BLAST matches underlined)
>35-K015440-022-295-C05-8409
TGATCCATGTAGATTTCCCAATTGTACCTAAATACATCTAAAGTCGTTCGGAGTGCTCAT
CCATGATCAGGTAATTGTTAGCCTTTAAATCTTGGCTACCTTCCTTTAAACTTTCGAAGT
GTTTGGGATAAATGAAAACAAGAACTTTGTTTGTGTAAGAACAGGGAATAGCACTGAGAG
GACTTTTCATAATCGACAAGGAAGGAGTGATCCAACATTCCACCATCAACAATCTTGGTA
TTGGCCGAAGCGTTGATGAGACAATGAGAACCCTCCAGGTAAAGATACAAATAAATACAC
ACAACTCCAAAAACCGCTCTTTCCTTTCACTCGATTTCCGGTATGCTTAATACGTTTTCA
ATGTTGCAGGCATTACAGTACATCCAGGAAAACCCGGATGAAGTCTGCCCAGCAGGATGG
AAGCCGGGTGAGAAGTCAATGAAACCCGACCCAAAACTCAGCAAAGAGTACTTCTCAGCT
ATTTAGAAACTCTACTATGATAGCAAAAAGGTACAATCTTTGTTATATGTGAGCAGAGTT
TTTTTTCTTGTACGCTAAAACAATCCTTTGTTTGATTCTCACTTTGTCCCCAAAATTATA
ATAAAAAACTTTTTCCGTTAATGGAAGTCTTATTGTGTTACGCCTACAAATTCATATTCA
GTTGATCACTTACCTAAGCATGTACACTGTACATATTAATGGGTAAAATCAAGACCATTT
TGTGATCTTCTTTGATAGCACAGAGAAGCCATTGTTCACCATATACGCTA
GenBank Accession AL946263 [GenBank]
Graphic View Graphic view of gene At3g11630
Predicted Position of Insertion Chr3:3673491 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F24K9
Hit Gene Code At3g11630 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Thioredoxin superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23