Sequences from confirmation amplicon


Confirmation sequences for line 296F05 and hit At1g04180 are shown.
Line ID 296F05
Locus At1g04180 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:1106083
Primers used for PCR MM67 - 8474, show primer details
   
Sequence Name 12-K020358-022-296-F05C-8409
GenBank Accession LN491373 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>12-K020358-022-296-F05C-8409
TAGATTTCCCGGACATGAAGCCATTTACATGAAAATTGGTAATCACTGCCATTTTTCTCT
TTACTCTATTTTACATTTTTCCTTTTGTATATTTTTACAAATAAATCGATTTATTTATAT
ATATCCTATTGAAAACCCCTAACGTGAGGCTTAAGCAACTGAGATGCATCTTCGGTGACC
CACATTTCTTCTCATCTTCTGTCGTTTGGTCTCTTCTCTCCACACATTTCCAATGTCTTG
AGCGATGTTAACGGCGTCTACTGATGCTCCAGCCAACCCTTTTCTCGTGAATCCGGCCGC
GTATAATCCCGATTTCCCTTTCCACGCGTTTGGAAACGGCGATTTCGGAAACCCATTTTT
CGAAAAGAACTCACTTTCCTGAAGCCAAGAAGGGACGTTGCTACGATAACCGGTGGCGAG
AACCACAGCGTCGATATCTAGCTTCTGACCATCTACGAGCTCCACGTGGTGACGCGAGAA
CTGTTTGA
   
Sequence Name 16-K020358-022-296-F05C-MM67
GenBank Accession LN493239 [GenBank]
Sequencing primer gene specific primer, MM67: 5'-TGTACCTGCAATCAAACAGTTCTC-3'
Sequence (A. th genome BLAST matches underlined)
>16-K020358-022-296-F05C-MM67
CGTGGAGCTCGTAGATGGTCAGAAGCTAGATATCGACGCTGTGGTTCTCGCCACCGGTTA
TCGTAGCAACGTCCCTTCTTGGCTTCAGGAAAGTGAGTTCTTTTCGAAAAATGGGTTTCC
GAAATCGCCGTTTCCAAACGCGTGGAAAGGGAAATCGGGATTATACGCGGCCGGATTCAC
GAGAAAAGGGTTGGCTGGAGCATCAGTAGACGCCGTTAACATCGCTCAAGACATTGGAAA
TGTGTGGAGAGAAGAGACCAAACGACAGAAGATGAGAAGAAATGTGGGTCACCGAAGATG
CATCTCAGTTGCTTAAGCCTCACGTTAGGGGTTTTCAATAGGATATATATAAATAAATCG
ATTTATTTGTAAAAATATACAAAAGGAAAAATGTAAAATAGAGTAAAGAGAAAAATGGCA
GTGATTACCAATTTTCATGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAAT
GAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAA
AAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAAT
TACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTT
TATTTCGA

Last Updated on 07.07.2016 14:16