SimpleSearch - Line and FST details


Line specific information

 
Line ID 296F05
Vector Used pAC161
Line Availability only available from NASC (N428385)
Segregation Analysis 53:49:37
Confirmed for Hit At1g04180
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g04180

 
Sequence (A. th genome BLAST matches underlined)
>38-K015495-022-296-F05-8409
TTTGATCCATGTAGCTTTCCTCGAATGAAGCACTTACACATGTATGCATGTCGACTCTAT
GGGATCCTCCTATAGTGAGACATNNTTCCTTTTGTATATTTTTACAAATAAATCGATTTA
TTTATATATATCCTATTGAAAACCCCTAACGTGAGGCTTAAGCAACTGAGATGCATCTTC
GGTGACCCACATTTCTTCTCATCTTCTGTCGTTTGGTCTCTTCTCTCCACACATTTCCAA
TGTCTTGAGCGATGTTAACGGCGTCTACTGATGCTCCAGCCAACCCTTTTCTCGTGAATC
CGGCCGCGTATAATCCCGATTTCCCTTTCCACGCGTTTGGAAACGGCGATTTCGGAAACC
CATTTTTCGAAAAGAACTCACTTTCCTGAAGCCAAGAAGGGACGTTGCTACGATAACCGG
TGGCGAGAACCACAGCGTCGATATCTATGGGATCCTC
GenBank Accession AL946448 [GenBank]
Graphic View Graphic view of gene At1g04180
Predicted Position of Insertion Chr1:1106090 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F20D22
Hit Gene Code At1g04180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation YUCCA 9
Insertion Classification 3' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03