Sequences from confirmation amplicon


Confirmation sequences for line 297G07 and hit At5g64600 are shown.
Line ID 297G07
Locus At5g64600 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:25825059
Primers used for PCR PH36 - 8474, show primer details
   
Sequence Name 55-K017545-022-297-G07C-PH36
GenBank Accession LN508655 [GenBank]
Sequencing primer gene specific primer, PH36: 5'-TGAAATCAATCAAAAGCACAGTTC-3'
Sequence (A. th genome BLAST matches underlined)
>55-K017545-022-297-G07C-PH36
TTCATAATCAAAACCCAAGATAGATCCATCAGAAATTGGAAGTGAGCTTCTTTGGCATAC
CTTTGTATTTCGGAGTAGGTTTGACACATGGATGCAACCCAAAGCTGAAAGGAGGAGTCC
AAAGTTGAGTATTTTCATACGGTTTCTGCAAATTCTGAAGCTCAATAAAGTTATGCTTTC
TCAATTGTTCCGATCAAAAACCAAATCAAGTCACCTCATTTCTTCATTCAAATCCACAAC
CCATGAAATATTAACAACTTTACCTTCCTAGGAGGCAAATACGGTGGCGGAAATGATTCT
GAATCGATTAGATCCCGATGATGTTGTTGTTGATGTTTGGTGTGGTCATCATCGGTTTGA
ATGTTTCTGGAGCTGAAGACGAGAACCCAGATGGTAAAAGCAAAGACGAAGATCAAGTAG
AGAGAAATAGCTTTTCTAGAGAAGAATCTTGCTATTGAAGAAGAATATGAGATTATCGAG
CGAGATGAGTTTCTGTGTTTCACCATCTTCGATGAAGAAGACAGATCTACAACGGTCTCT
TTCCTCCTCCGGACATCGAGCTTTTGCTTGTTCAAAACCAAACCGGTTTTGAAATTGCTG
TTTTACCGGAATTTTTGATAACGTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACAT
GGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTT
TTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATA
AAACGACAAATT
   
Sequence Name 59-K017545-022-297-G07C-8409
GenBank Accession LN509851 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>59-K017545-022-297-G07C-8409
CCCGGATATGAAGCCATTTACAATTGACGTTATCAAAAATTCCGGTAAAACAGCAATTTC
AAAACCGGTTTGGTTTTGAACAAGCAAAAGCTCGATGTCCGGAGGAGGAAAGAGACCGTT
GTAGATCTGTCTTCTTCATCGAAGATGGTGAAACACAGAAACTCATCTCGCTCGATAATC
TCATATTCTTCTTCAATAGCAAGATTCTTCTCTAGAAAAGCTATTTCTCTCTACTTGATC
TTCGTCTTTGCTTTTACCATCTGGGTTCTCGTCTTCAGCTCCAGAAACATTCAAACCGAT
GATGACCACACCAAACATCAACAACAACATCATCGGGATCTAATCGATTCAGAATCATTT
CCGCCACCGTATTTGCCTCCTAGGAAGGTAAAGTTGTTAATATTTCATGGGTTGTGGATT
TGAATGAAGAAATGAGGTGACTTGATTTGGTTTTTGATCGGAACAATTGAGAAAGCATAA
CTTTATTGAGCTTCAGAATTTGCAGAAACCGTATGAAAATACTCAACTTTGGACTCCTCC
TTTCAGCTTTGGGTTGCATCCATGTGTCAAACCTACTCCGAAATACAAAGGTATGCCAAA
GAAGCTCACTTCCAATTTCTGATGGATCTATCTTGGGTTTTGTTTATGAATTCAGAACTG
TGCT

Last Updated on 23.10.2014 13:25