SimpleSearch - Line and FST details


Line specific information

 
Line ID 297G07
Vector Used pAC161
Line Availability only available from NASC (N428495)
Segregation Analysis 50:34:25
Confirmed for Hit At5g64600
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g64600

 
Sequence (A. th genome BLAST matches underlined)
>55-K015513-022-297-G07-8409
NTTTTGATCCATGTAGATTTCCTCGGACATGAAGCCTTTACAATTGACGTTATCACAAAA
TTGCCGGTATAAACGCAATTTCAAACCGGTTTGGTTTTGAACAGCAAAAGCTCGATGTCC
GGAGGAGGAAAGAGACCGATGTAGATCTGTCTTCTTCATCGAAGATGGCGAAACAGCAGA
AACTCATCTCGCTCGAGAGATCTCAGTATTCTTCTTCAATAGCAAGATTCTTCTCTATGG
GATCCTCCCTTNAGTGAG
GenBank Accession AL946608 [GenBank]
Graphic View Graphic view of gene At5g64600
Predicted Position of Insertion Chr5:25825059 - go to primer design
BLAST e Value 7e-58
Hit Clone Code (BAC ID) MUB3
Hit Gene Code At5g64600 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation O-fucosyltransferase family protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03