Sequences from confirmation amplicon


Confirmation sequences for line 299G09 and hit At1g52410 are shown.
Line ID 299G09
Locus At1g52410 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:19521846
Primers used for PCR TS03 - 8474, show primer details
   
Sequence Name 13-K026796-022-299-G09C-8409
GenBank Accession LN491880 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>13-K026796-022-299-G09C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTTCAAACTCATGTTCGA
TTCTTCCAACATTTTCTGTCTATGAGCAGCTGAAACAAGACACAATAACAACTACATCAG
CAAAAGAAAGAACTATTGAAGAAACAAAGAATTTCATAGAAGAAAATCTTACATAATTCT
TCATCATCATCCTTGGATTCAGCCTTGACACCATCAGATCCAGCTTGGTTAATACTATTG
TGATGAGCTGCAATTAATCATGATACACAATTATATACAAAAACTTTACTAAACATCAAT
TTCTGATTAACTATATAGTAAAATAAATAAGGGCCTTTCATGTTTCACACCATAAACACA
ATCACTAAGATCAAGATCTTGAGATACCTTCGAATTCAAGTTTGATTTGATCCAACAGAC
TCGAACGTCCAACGCTTTCATCACTAACAGATCCAACCTAAACACACACAGCAAAGACAA
   
Sequence Name 14-K026796-022-299-G09C-TS03
GenBank Accession LN492349 [GenBank]
Sequencing primer gene specific primer, TS03: 5'-AAGGTGAATTTTTGTCTTTGCTGT-3'
Sequence (A. th genome BLAST matches underlined)
>14-K026796-022-299-G09C-TS03
TGTGTTTAGGTTGGATCTGTTAGTGATGAAAGCGTTGGACGTTCGAGTCTGTTGGATCAA
ATCAAACTTGAATTCGAAGGTATCTCAAGATCTTGATCTTAGTGATTGTGTTTATGGTGT
GAAACATGAAAGGCCCTTATTTATTTTACTATATAGTTAATCAGAAATTGATGTTTAGTA
AAGTTTTTGTATATAATTGTGTATCATGATTAATTGCAGCTCATCACAATAGTATTAACC
AAGCTGGATCTGATGGTGTCAAGGCTGAATCCAAGGATGATGATGAAGAATTATGTAAGA
TTTTCTTCTATGAAATTCTTTGTTTCTTCAATAGTTCTTTCTTTTGCTGATGTAGTTGTT
ATTGTGTCTTGTTTCAGCTGCTCATAGACAGAAAATGTTGGAAGAAATCGAACATGAGTT
TGAAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAAT
GAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAA
AAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAAT
TACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTT
TATNTCGACGTGTCTAC

Last Updated on 07.07.2016 14:16