SimpleSearch - Line and FST details


Line specific information

 
Line ID 299G09
Vector Used pAC161
Line Availability only available from NASC (N428689)
Segregation Analysis 50:42:30
Confirmed for Hit At1g52410
Parent of DUPLO pair 2818
Parent of pair(s) none

Gene hit At1g52410

 
Sequence (A. th genome BLAST matches underlined)
>71-K015556-022-299-G09-8409
NTTTTGATCACTGTAGATTNTCCCGGACATGAANGCCTTTACAATTGAATCTATCCTTCA
AACTCATGTTGGATCTCTTCCGCATTCGCTGACTATGAGCACCTGCGCCATGACACTTGA
CAACTACTTCGTCTTAAGAGGCATCTGTTGGCGAGACCATGAATTTCATACAGGAAAATG
TTGATCATCCTGTATCATCATCCTTGGAGTACCCCTTGACTCCATCTTATCCTGCTCGGT
TAATACTATTGCGATGACCGGCCATTGTCACTGAGCACAGTCCTATACGACATCTCTGCT
AAACATCCGCTTCTGATTAACTGTGTGAGCTACTCAATGACGGGCTCTTATGTTCCTCAC
CATACACCCCTTCACTAATATCGAGATGTTGGGATACCTTCGAAGTCTACGTTGATTTGC
TCCGGCTGACTCGCACGTCCGACGCTGTCATCGCTAACGGATGCAACCTAGGCGCACACG
GCGGAGACGCGACATGCACCTGTAATTAAGGATACGAAAAACTACCGAGCCGGAATCTCT
CTATTACTTCCATTCATCGTAATGCATATATCTACTTAATGAGCAACGCGGCGGAGCGCT
GAACCCTAACCTCATATTCATGTGATAGAGATAGAGAAATAGTGATCCTATCACGCACTG
GGATGTACTTTGGGNNGGGGTGNACCCTCGTGATCTTTGGCGGCTGGAAGACACACANGA
ACATTAGAAGCTGTCACAAACATAACAAAAATAGAATCCNNGGAAAGAGATATANGAGAG
AGAGATCTTACACTGATCTTCATCGTCCTTGCCTT
GenBank Accession FR807422 [GenBank]
Graphic View Graphic view of gene At1g52410
Predicted Position of Insertion Chr1:19521849 - go to primer design
BLAST e Value 2e-30
Hit Clone Code (BAC ID) F19K6
Hit Gene Code At1g52410 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation TSK-associating protein 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR807422 [GenBank]


Last Updated on 31.08.2016 09:40