Sequences from confirmation amplicon


Confirmation sequences for line 300A04 and hit At2g37250 are shown.
Line ID 300A04
Locus At2g37250 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:15642620
Primers used for PCR GL12 - 8474, show primer details
   
Sequence Name 28-K020358-022-300-A04C-8409
GenBank Accession LN498654 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>28-K020358-022-300-A04C-8409
TAGATTTCCCGGACATGAGATTGTTAATTGTTTCTTGTCAATTGGTTTCTGATGAGATCA
TTGTAGACTTATTGTCCAAAAGACTTGAGGCTGGTGAAGCTAGAGGTGAATCAGGGTTTA
TCCTTGATGGCTTTCCTCGTACCATGAGACAAGCTGTAAGTATTATTCGTTTTAAGCAAT
TTTTGATAATCAATCTCCATTATCATTTCTAACAGTGGATTGTCTTTTGGTTCAGGAAAT
ACTGGGAGATGTAACTGACATCGATTTGGTGGTGAATTTGAAGCTTCCTGAGGAAGTTTT
GGTTGACAAATGCCTTGGAAGGAGAACATGTAGTCAATGTGGCAAGGGTTTAAATGTA
   
Sequence Name 32-K020358-022-300-A04C-GL12
GenBank Accession LN500397 [GenBank]
Sequencing primer gene specific primer, GL12: 5'-CTACATTAAAACCCTTGCCACATT-3'
Sequence (A. th genome BLAST matches underlined)
>32-K020358-022-300-A04C-GL12
CATGTTCTCCTTCCAAGGCATTTGTCAACCAAAACTTCCTCAGGAAGCTTCAAATTCACC
ACCAAATCGATGTCAGTTACATCTCCCAGTATTTCCTGAACCAAAAGACAATCCACTGTT
AGAAATGATAATGGAGATTGATTATCAAAAATTGCTTAAAACGAATAATACTTACAGCTT
GTCTCATGGTACGAGGAAAGCCATCAAGGATAAACCCTGATTCACCTCTAGCTTCACCAG
CCTCAAGTCTTTTGGACAATAAGTCTACAATGATCTCATCAGAAACCAATTGACAAGAAA
CAATTAACAATCTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAAT
ATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGC
AGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATT
TATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTA
CATTCA

Last Updated on 23.10.2014 13:25