SimpleSearch - Line and FST details


Line specific information

 
Line ID 300A04
Vector Used pAC161
Line Availability only available from NASC (N428708)
Segregation Analysis 100:91:70
Confirmed for Hit At2g37250
Parent of DUPLO pair none
Parent of pair(s) 12455

Gene hit At2g37250

Sequence (A. th genome BLAST matches underlined)
>25-K015599-022-300-A04-8409
TTGATCCATGTAGATTTCCCGGACATGAGATTGTTAATTGTTTCTTGTCACTTGGTTTCT
GATGAGATCATTGTAGACTTATTGTCCAAAAGACTTGAGGCTGGTGAAGCTAGAGACTCC
GTGCTTATTCCGTTTCTTATAGTTCGAATTGATCTATCGATATCCAGCTGGCAGCCGTCA
GCTGGAGTACTGGCTACAATAAGGAGACGAACTGATACGTCTACACGCNTGCCCTAACTT
GATACTTGCTCCAATATACCATGTGACCCTGCGGATACCCCCTACTATAGACGAGCGAGC
ATGCAACCCATTCATATGTACACGTACGGTCG
GenBank Accession AL946914 [GenBank]
Graphic View Graphic view of gene At2g37250
Predicted Position of Insertion Chr2:15642622 - go to primer design
BLAST e Value 5e-28
Hit Clone Code (BAC ID) F3G5
Hit Gene Code At2g37250 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation adenosine kinase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Carrari et al. 2005, adk1-1]
Other FSTs Supporting this Hit AL946915 [GenBank]


Last Updated on 31.08.2016 09:40