Sequences from confirmation amplicon


Confirmation sequences for line 300A06 and hit At1g10130 are shown.
Line ID 300A06
Locus At1g10130 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:3311396
Primers used for PCR RM06 - 8474, show primer details
   
Sequence Name 31-K022052-022-300-A06C-8409
GenBank Accession LN499979 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>31-K022052-022-300-A06C-8409
AGATTTCACGTATTTTAATTTCACGTGACATGATTACCAACAAAGGGTCTTTCTGATTCT
CAGGTATGAACCTGTTGAACCGAATTGAGATCTCCATTGTTACTTGAACTTTGTAAAGTC
ACTTCAAAGCTACCCATGATGTTAATCTTTCGTTTCCGTATATGTAGGTTGTTCATCATT
CCAGGCTTTATGGCAGGAATGGTATGTATTACTTCCACTTCACTTGCACTTCTGTTCATA
TAAAGCATCACTCAGGGACATAAGGATATTTCATGCAGATGGTGATGATAGGGTGTCTTG
GTGTTTATTGTTCTTTTCAATTAGGCATATGGAATTTAAGTGAGCTGTTGATTATAGTTT
TCGCATGTATTTATAGTTTAGCATTGTAAATTACTTGTCAAGTATCCAGTTTGAGTATCC
TTGAGACGAAAGTCCTGCATACGATTGTCTGTGCGTTTAAACATTCGGCACTCTATGGAA
TTAGTGTCGCCTTTAACTGGAAAATGCATACCTTTTTCATAGTGGATAGCACATATTATA
TTTACCTTGTTTAGTTCTGATCTTCTTCTTTAAATTTTTTTGCATGTTTCTTCACATGAT
CTGCAGTACTGCCTGAAGAGAAAAGTAAGTTTGTCAATAACCGCCTATGATAATGGATAG
CTTACTTTCATAATTGCTTCAGTTTTATTTCTAATCCCTGATCTACCATTATGGTTTGGG
AGAACCTTAACTGTTTTAG
   
Sequence Name 32-K022052-022-300-A06C-RM06
GenBank Accession LN500406 [GenBank]
Sequencing primer gene specific primer, RM06: 5'-TTACAATCATCACAGCGCTAAAAC-3'
Sequence (A. th genome BLAST matches underlined)
>32-K022052-022-300-A06C-RM06
AAGTTCTCCCAAACCATAATGGTAGATCAGGGATTAGAAATAAAACTGAAGCAATTATGA
AAGTAAGCATCCATTATCATAGGCGGTTATTGACAAACTTACTTTTCTCTTCAGGCAGTA
CTGCAGATCATGTGAAGAAACATGCAAAAAAATTTAAAGAAGAAGATCAGAACTAAACAA
GGTAAATATAATATGTGCTATCCACTATGAAAAAGGTATGCATTTTCCAGTTAAAGGCGA
CACTAATTCCATAGAGTGCCGAATGTTTAAACGCACAGACAATCGTATGCAGGACTTTCG
TCTCAAGGATACTCAAACTGGATACTTGACAAGTAATTTACAATGCTAAACTATAAATAC
ATGCGAAAACTATAATCAACAGCTCACTTAAATTCCATATGCCTAATTGAAAAGAACAAT
AAACACCAAGACACCCTATCATCACCATCTGCATGAAATATCCTTATGTCCCTGAGTGAT
GCTTTATATGAACAGAAGTGCAAGTGAAGTGGAAGTAATACATACCATTCCTGCCATAAA
GCCTGGAATGATGAACAACCTACATATACGGAAACGAAAGATTAACATCATGGGTAGCTT
TGAAGTGACTTTACAAAGTTCAAGTAACAATGGAGATCTCAATTCGGTTCAACAGGTTCA
TANCCTGAGAATCAGAAAGACCCTTTGTTGGTAATCATGTCACGTGAAATTAAAATACGT
GAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAAT
TACCAATTTTTTTTCAATTCAAAAATG

Last Updated on 23.10.2014 13:25