SimpleSearch - Line and FST details


Line specific information

 
Line ID 300A06
Vector Used pAC161
Line Availability only available from NASC (N428710)
Segregation Analysis 100:93:78
Confirmed for Hit At1g10130
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F3O9

 
Sequence (A. th genome BLAST matches underlined)
>41-K015600-022-300-A06-8409
TTTTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACAATTGAATATACTCATTCG
CTGATCCGACCACGAACAGCCAACTATTACTTATCGTGAGCGTAGATGCATCTTGATATC
ATAAAGAAATCTTCTTATTTATATTAATGTACGTTGTTGTGAAACTTCTTGCGAACCGTA
CTACATCACTACTATAATAGTCACTACACTCTATACAATATAGCCCAAAATAACTGGGAT
TCGTCGATTTTGAATTACTTGAATAACAACTTAGCGTGATAAACGACATGGCCTGCATGT
GTGTACGTAGATTTGGGGAGGGGTCAAATAATCTAAGTATGATACATTGATACTGAACGA
CCCTCCTTTCTAGCTCGCTATCCAAACAAGAGACGGACAGATGGGCGGTGGATGCCATCG
AAGGAGGCGGCCGGTACCCACCGTTGGAAGAAAAGAATCGCCCGCCCGTCGGACGACACA
GACTGTA
GenBank Accession AL946919 [GenBank]
Graphic View Graphic view of sequence AL946919 of line 300A06
Predicted Position of Insertion Chr1:5653608 - go to primer design
BLAST e Value 1e-40
Hit Clone Code (BAC ID) F3O9
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At1g10130

 
Sequence (A. th genome BLAST matches underlined)
>41-K015599-022-300-A06-8409
CACTGCAAAGCTACCCCTGAGGTTAATATCTCGTTGCCGAATATGTACGATGATACTACT
TTCCAGGCCTTATATCGGCAGGAAAGGTAAGCCTAACTTCCAGCTTTCTGGCACTTCTGA
ACATCTAGAGCATCACCCAACGACATTAAGCTACATGGTGCGCATGGTGAACATAGGGTG
GCGGAGGGGTCATAGAACCTAAGAATTATGCATATGGACTATGGGAGACCTGCTGTGGAG
AGTTTTCGCATGTATTTATAGTTTAGCATTGTAAATTACTTGTCAAGTATCCAGTTTGAG
TATCCTTGAGACGAAAGTCCTGCATACGATTGTCTGTGCGTTTAAACATTCGGCACTCTA
TGGAATTAGTGTCGCCTTTAGCTGGAAAATGCATACCTTTTTCATAGTGGATACCACATA
TTATATTTACCTTGCTTAAGCCCCGATCTTCCCCTTTAAATTCTTTTGCGTGTGACTTCA
CATGATCT
GenBank Accession AL946918 [GenBank]
Graphic View Graphic view of gene At1g10130
Predicted Position of Insertion Chr1:3311389 - go to primer design
BLAST e Value 2e-104
Hit Clone Code (BAC ID) T27I1
Hit Gene Code At1g10130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation endoplasmic reticulum-type calcium-transporting ATPase 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03