Sequences from confirmation amplicon


Confirmation sequences for line 306C09 and hit At1g61580 are shown.
Line ID 306C09
Locus At1g61580 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:22721927
Primers used for PCR RS23 - 8474, show primer details
   
Sequence Name 15-K024450-022-306-C09C-8409
GenBank Accession LN492797 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>15-K024450-022-306-C09C-8409
GTAGATTTCCCGGACATGAAGCCATTTACCATTGGAGGTGTCTCAATGATCGTCACAGCT
TCACATGTTTCCTTCTTGTGTAGTTCTGTCAACAATATTAATAAAAAGTTAAGTACAAAA
CCACATGCAAAAATTAAGACTTGATAAGAGAAGAGAGTGAGAACACACTTGATCCAGGTT
TTTCAACATCTCTCACAATGTGAGTCATCCCAGCTTTGTATCCCAAGAAGGAGGTGAGTC
TGCAAGGCTTAGTTGGATCATCCTTAGGGAAGGCCTTCACTGGAAAAACACAATCAAGGA
ATATAAGAACAACACTACATAGAAGCATACACAAAACATTTTTGACATCAAAGAAAACCT
CAGCTCATTCTACTAAGTACACAGAAGTAGCAATAAATAGGTGAATAGATGAAATTACCT
TTCCCACGGTGTCGGCTAGCTCTTTTCCTTGGAAGGAAACCCAAAGAACCATGTCTTGGA
TGCTCAAACTTTCTGTGAGACATTCTTTCAACCAGAAACAAATACTAGAAAATAAGATAA
AAACTTATAAACACAGCAGATAACATCTAACAAATCCAATGACAAAACCAAGCAAGAACA
AAAAGGTCCCATGTACTC
   
Sequence Name 16-K024450-022-306-C09C-RS23
GenBank Accession LN493266 [GenBank]
Sequencing primer gene specific primer, RS23: 5'-TGAGATTTTTGCTTGAGTACATGG-3'
Sequence (A. th genome BLAST matches underlined)
>16-K024450-022-306-C09C-RS23
TTTTTGTTCTTGCTTGGTTTTGTCATTGGATTTGTTAGATGTTATCTGCTGTGTTTATAA
GTTTTTATCTTATTTTCTAGTATTTGTTTCTGGTTGAAAGAATGTCTCACAGAAAGTTTG
AGCATCCAAGACATGGTTCTTTGGGTTTCCTTCCAAGGAAAAGAGCTAGCCGACACCGTG
GGAAAGGTAATTTCATCTATTCACCTATTTATTGCTACTTCTGTGTACTTAGTAGAATGA
GCTGAGGTTTTCTTTGATGTCAAAAATGTTTTGTGTATGCTTCTATGTAGTGTTGTTCTT
ATATTCCTTGATTGTGTTTTTCCAGTGAAGGCCTTCCCTAAGGATGATCCAACTAAGCCT
TGCAGACTCACCTCCTTCTTGGGATACAAAGCTGGGATGACTCACATTGTGAGAGATGTT
GAAAAACCTGGATCAAGTGTGTTCTCACTCTCTTCTCTTATCAAGTCTTAGATTTTTGCA
TGTGGTTTTGTACTTAACTTTTTATTAATATTGTTGACAGAACTACACAAGAAGGAAACA
TGTGAAGCTGTGACGATCATTGAGACACCTCCAATGGTAAATGGCTTCATGTCCGGGAAA
TCTACATGGATCAGCAATGAGTATGAATGGTCAATATGGAGAAAAAGAAAGAGTAATTAC
CAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACA
TTTTGATAAAACGACAAATTACGGACCGTCGTATTTATAGGCGAAAGCAATAAACAAATT
ATTCTAATTCGGAAATCTTTATTTCGACGTGTCTAC

Last Updated on 07.07.2016 14:16