SimpleSearch - Line and FST details


Line specific information

 
Line ID 306C09
Vector Used pAC161
Line Availability only available from NASC (N429313)
Segregation Analysis 50:38:26
Confirmed for Hit At1g61580
Parent of DUPLO pair none
Parent of pair(s) 9497

Gene hit At1g61580

 
Sequence (A. th genome BLAST matches underlined)
>67-K015575-022-306-C09-8409
NTGATCCATGTAGCATTTCCCGGACATGAANGCCTTTACCATTGGAGGTGTCTCAATGAT
CGTCACAGCTTCACATCTTTCCTTCTTGTGTAGTTCTGTCAACAATATTAATAAGAAGTT
AAGTACAAACCCACATGCAAAAATTAAGACTGGATAAGATAAGAGAGTGAGAACACACTT
GATCCAGGTTTTTCAACATCTCTCACAATGTGAGTCATCCCAGCTTTGTATCCCAAGAAG
GAGGTGAGTCTGCAAGGCTTAGTTGGATCATCCTTAGGGAAGGCCTTCACTGGAAAAACA
CAATCAAGGAATATAAGAACAACACTACATAGAAGCATACACAAAACATTTTTGACATCA
AAGAAAACCTCAGCTCATTCTACTAAGTACACAGAAGTAGCAATAAATAGGTGAATAGAT
GAAATTACCTTTCCCACGGTGTCGGCTATGGGATC
GenBank Accession AL947684 [GenBank]
Graphic View Graphic view of gene At1g61580
Predicted Position of Insertion Chr1:22721927 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T25B24
Hit Gene Code At1g61580 [TAIR] [MIPS] [SIGnAL]
Gene Annotation R-protein L3 B
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23