Sequences from confirmation amplicon


Confirmation sequences for line 309G01 and hit At4g31710 are shown.
Line ID 309G01
Locus At4g31710 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:15351752
Primers used for PCR RD02 - 8474, show primer details
   
Sequence Name 33-K024136-022-309-G01C-RD02
GenBank Accession LN500835 [GenBank]
Sequencing primer gene specific primer, RD02: 5'-AATGAATCTCTCTGATATGCCACA-3'
Sequence (A. th genome BLAST matches underlined)
>33-K024136-022-309-G01C-RD02
CCTTTGCAGCACGTTCTTGATGCTCGTTTCAGTTGGATTGAGCTGTTGTGTTGTGAGAAG
CGATGACAAACTGGCAGTATAACTCTGAGTCAGCACAAGAACAATGAAGTACCAAGTGAT
AACCACAACCCTTGCTGTAAAGCTCATTACTCTTTCTCCTGTAAAAACATAACTTTTGAG
AGTAAACTTATGGAAACAGACTCGTTGCCTACAGAGAGTACTAGAGGGAAAGCGAACATA
CTGGGTGCAAAAACCATGATGGAGAAGGCAAACCAGAACATAGTGCTGATCTGGTACTGG
GGAGGTCCAGTGAATTCAGAGTTCACCCTATGTTCAAGAATCCACACAACAAAACCAACA
ACAAAAAAAGAACCAAGGGTCATCCCCCAAAGCCCCGGTGTCAAAGGTTTAAAAAAGATC
AAACTGCTTCTTGCCACGTTATCTTTTAGAGGCAAAGTGAAATGGCTTCATGTCCGGGAA
ATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTAC
CAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACA
TTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATT
ATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTC
   
Sequence Name 34-K024136-022-309-G01C-8409
GenBank Accession LN501257 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>34-K024136-022-309-G01C-8409
CATGTAGATTTCCCGGACATGAAGCCATTTCACTTTGCCTCTAAAAGATAACGTGGCAAG
AAGCAGTTTGATCTTTTTTAAACCTTTGACACCGGGGCTTTGGGGGATGACCCTTGGTTC
TTTTTTTGTTGTTGGTTTTGTTGTGTGGATTCTTGAACATAGGGTGAACTCTGAATTCAC
TGGACCTCCCCAGTACCAGATCAGCACTATGTTCTGGTTTGCCTTCTCCATCATGGTTTT
TGCACCCAGTATGTTCGCTTTCCCTCTAGTACTCTCTGTAGGCAACGAGTCTGTTTCCAT
AAGTTTACTCTCAAAAGTTATGTTTTTACAGGAGAAAGAGTAATGAGCTTTACAGCAAGG
GTTGTGGTTATCACTTGGTACTTCATTGTTCTTGTGCTGACTCAGAGTTATACTGCCAGT
TTGTCATCGCTTCTCACAACACAACAGCTCAATCCAACTGAAACGAGCATCAAGAACGTG
CTTGCAAAAGGAGGACCTGTGGCATATCA

Last Updated on 23.10.2014 13:25