SimpleSearch - Line and FST details


Line specific information

 
Line ID 309G01
Vector Used pAC161
Line Availability only available from NASC (N429641)
Segregation Analysis 50:43:39
Parent of DUPLO pair none
Parent of pair(s) 4304, 4483, 94158

Gene hit At4g31710

 
Sequence (A. th genome BLAST matches underlined)
>07-K015784-022-309-G01-8409
TATCATGAGATTTCCCGGACATGAAGCCATTTCACTTTGCCTCTAAAGATAACGTGGCAA
GAAGCAGTTTGATCTTTTTTAAACCTTTGACACCGGGGCTTTGGGGGATGACCCTTGGTT
CTTTTTTTGTTGTTGGTTTTGTTGTGTGGATTCTTGAACATAGGGTGAACTCTGAATTCA
CTGGACCTCCCCAGTACCAGATCAGCACTATGTTCTGGTTTGCCTTCTCCATCATGGTTT
TTGCACCCAGTATGTTCGCTTTCCCTCTATGGGATCCGCCTTATAGTGAGACNATCNCCA
TAGGCTTCCCAAACTCTGATGTTA
GenBank Accession AL948090 [GenBank]
Graphic View Graphic view of gene At4g31710
Predicted Position of Insertion Chr4:15351758 - go to primer design
BLAST e Value 1e-111
Hit Clone Code (BAC ID) F28M20
Hit Gene Code At4g31710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation glutamate receptor 2.4
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit AL948091 [GenBank]


Last Updated on 07.07.2016 14:03