Sequences from confirmation amplicon


Confirmation sequences for line 310A04 and hit At4g40060 are shown.
Line ID 310A04
Locus At4g40060 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:18571512
Primers used for PCR HF03 - 8474, show primer details
   
Sequence Name 09-K027433-022-310-A04C-8409
GenBank Accession LN490031 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>09-K027433-022-310-A04C-8409
CCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATTACATATTAATTACATG
AAGAGCCATTACAATCTTAAACCCAAAATTAACTTCTCCCGCGGATTTAATTTAATAATC
CCCTTCATCCTTAATCCTTATTTATCAATTATTCCACCTTTGCCCTCTTCTCTGTTTTCC
CATTGAGACTAAACAGAGCACCAATTTGATAAACAATTCTCAAGTCCAATGATCTGAAGC
AGAGTACCAATGAAGTGACGGCGGCTGTTCATCGGAGAAGAAACCACAAGCTTCTTCACC
GCTTAGAAAATCCTCGTGATCCTCTGTTTGCTCTGTTTTCACAAACTGTAAGAAACTCCC
GCCAGTAACCGTCACAGGCGGCGTCAATCTTCCGTTATCAGAACTTGTTTCGTCGTTAAG
AACGGCGCTTGAATCGCAACTATCGGAAGATCCAGCCTCGACAACGGTGGAATTCGGTAG
AAGGTCACGGAGGTCAGTGAAGCTTCGCCGGTAGTTAAAACCAGAGGAATGTTCTAGAAA
CTGCAGAGGAGACGAAGGAATCGAATCCGTCTTGTGAACTTCCTCTTCCTTAACACCCTC
CGTAATAGCTTTGTTGTTGTTGTTAT
   
Sequence Name 10-K027433-022-310-A04C-HF03
GenBank Accession LN490505 [GenBank]
Sequencing primer gene specific primer, HF03: 5'-ACGGTGAAGAAGATAACAACAACA-3'
Sequence (A. th genome BLAST matches underlined)
>10-K027433-022-310-A04C-HF3
AAAGCTATTACGCGAGGTGTTAAGGAAGAGGAAGTTCACAAGACGGATTCGATTCCTTCG
TCTCCTCTGCAGTTTCTAGAACATTCCTCTGGTTTTAACTACCGGCGAAGCTTCACTGAC
CTCCGTGACCTTCTACCGAATTCCACCGTTGTCGAGGCTGGATCTTCCGATAGTTGCGAT
TCAAGCGCCGTTCTTAACGACGAAACAAGTTCTGATAACGGAAGATTGACGCCGCCTGTG
ACGGTTACTGGCGGGAGTTTCTTACAGTTTGTGAAAACAGAGCAAACAGAGGATCACGAG
GATTTTCTAAGCGGTGAAGAAGCTTGTGGTTTCTTCTCCGATGAACAGCCGCCGTCACTT
CATTGGTACTCTGCTTCAGATCATTGGACTTGAGAATTGTTTATCAAATTGGTGCTCTGT
TTAGTCTCAATGGGAAAACAGAGAAGAGGGCAAAGGTGGAATAATTGATAAATAAGGATT
AAGGATGAAGGGGATTATTAAATTAAATCCGCGGGAGAAGTTAATTTTGGGTTTAAGATT
GTAATGGCTCTTCATGTAATTAATATGTAATATTCAATTGTAAATGGCTTCATGTCCGGG
AAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATT
ACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTA
CATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAA
TTATTCTAATTC

Last Updated on 07.07.2016 14:16