SimpleSearch - Line and FST details


Line specific information

 
Line ID 310A04
Vector Used pAC161
Line Availability only available from NASC (N429668)
Segregation Analysis 50:39:26
Confirmed for Hit At4g40060
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g40060

 
Sequence (A. th genome BLAST matches underlined)
>25-K015791-022-310-A04-8409
GATCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATTACATATTAATTACA
TGAAGAGCCATTACAATCTTAAACCCAAAATTAACTTCTCCCGCGGATTTAATTTAATAA
TCCCCTTCATCCTTAATCCTTATTTATCAATTATTCCACCTTTGCCCTCTTCTCTGTTTT
CCCATTGAGACTAAACAGAGCACCAATTTGATAAACAATTCTCAAGTCCAATGATCTGAA
GCAGAGTACCAATGAAGTGACGGCGGCTGTTCATCGGAGAAGAAACCACAAGCTTCTTCA
CCGCTTAGAAAATCCTCGTGATCCTCTGTTTGCTCTGTTTTCACAAACTGTAAGAAACTC
CCGCCAGTAACCGTCACAGGCGGCGTCAATCTTCCGTTATCAGAACTTGTTTCGTCGTTA
AGAACGGCGCTTGAATCGCAACTATCGGAAGATCCAGCCTCGACAACGGTGGAATTCGGT
AGAAGGTCACGGAGGTCAGTGAAGCTTCGCCGGTAGTTAAAACCAGAGGAATGTTCTATG
GGACTNCCCNATAAAAGGGAGAANNNNNNNNNNNNTTTTTTTTTTTTTTTTAAAAAAAAA
AGAATGGTTTTTGGGATTTT
GenBank Accession AL948128 [GenBank]
Graphic View Graphic view of gene At4g40060
Predicted Position of Insertion Chr4:18571512 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T5J17
Hit Gene Code At4g40060 [TAIR] [MIPS] [SIGnAL]
Gene Annotation homeobox protein 16
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23