Sequences from confirmation amplicon


Confirmation sequences for line 313F03 and hit At5g18410 are shown.
Line ID 313F03
Locus At5g18410 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:6103494
Primers used for PCR MB09 - 8474, show primer details
   
Sequence Name 33-K023495-022-313-F03C-8409
GenBank Accession LN500829 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>33-K023495-022-313-F03C-8409
GATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGAAATACTCGTTTTATATA
AATTCCTGTATCAGAAATAATGTGCGTATATTCTCTGTCTGTGCAGTTAGCTGCTGACAT
GCAGCGGTTTTCCAGACCTGAACGGCGGATCAATGGTCCCACAGTCACACATCTTTGGTG
GGTTATAACTCTTATTTTGTGTTTTGTATTAGATCCTTGGATGATTAACTTTCCTCGTGT
ATATAGTTTAACTGTGATTTTACTTAATATAGGTCAATGCTAAAGTTGCTTGACGTCTTG
GTTCAGCTGGATCATCTTAAAAATGCTAAAGCTAGCATTCCTAATGATTTCTCTTGGTAT
AAGAGGTGAAAGATATAATACTTTTATCTTTCCTATCTATATTTTCTGCAAATAGGACAC
TTGAATGTAGGTAGATCGATGTTTGTTACTAATCCTTTCAGCTACTAAAGCTCTATTTAA
GAGTTGAATTAGTTTCCTAGAAGCTTTTTTTTTTAGTTTATGTTCTTAAGATAGTTTCAC
TCTTTTCAGAACATTCACTCAAGTCAGTGCGCAGTGGCAAGATACAGATACAATGA
   
Sequence Name 34-K023495-022-313-F03C-MB09
GenBank Accession LN501253 [GenBank]
Sequencing primer gene specific primer, MB09: 5'-ACCTGCAAGTCGTCTAACTCTTCT-3'
Sequence (A. th genome BLAST matches underlined)
>34-K023495-022-313-F03C-MB09
TATCTGTATCTTGCCACTGCGCACTGACTTGAGTGAATGTTCTGAAAAGAGTGAAACTAT
CTTAAGAACATAAACTAAAAAAAAAAGCTTCTAGGAAACTAATTCAACTCTTAAATAGAG
CTTTAGTAGCTGAAAGGATTAGTAACAAACATCGATCTACCTACATTCAAGTGTCCTATT
TGCAGAAAATATAGATAGGAAAGATAAAAGTATTATATCTTTCACCTCTTATACCAAGAG
AAATCATTAGGAATGCTAGCTTTAGCATTTTTAAGATGATCCAGCTGAACCAAGACGTCA
AGCAACTTTAGCATTGACCTATATTAAGTAAAATCACAGTTAAACTATATACACGAGGAA
AGTTAATCATCCAAGGATCTAATACAAAACACAAAATAAGAGTTATAACCCACCAAAGAT
GTGTGACTGTGGGACCATTGATCCGCCGTTCAGGTCTGGAAAACCGCTGCATGTCAGCAG
CTAACTGCACAGACAGAGAATATACGCACATTATTTCTGATACAGGAATTTATATAAAAC
GAGTATTTCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATC
AGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCA
ATTCAAA

Last Updated on 23.10.2014 13:25