SimpleSearch - Line and FST details


Line specific information

 
Line ID 313F03
Vector Used pAC161
Line Availability only available from NASC (N430015)
Segregation Analysis 50:32:20
Confirmed for Hit At5g18410
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g18410

 
Sequence (A. th genome BLAST matches underlined)
>22-K015822-022-313-F03-8409
GATCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATACAGGAAAGTTTTCCAA
TAATGTATTTTTCTCATTTTTGGTTTTCTTTATGGGCACGATTTTAGTGGGCTGAATTTT
GATAAAGGCCCACATATGAAAGATATTTAGGGTTTTTTCTCTTGATACCTTTTAAAACGC
CGTCGAGAAATCTCCCCCTATGGGATCCTCGGCTATAGTGAGATCCTTGGATGATTAACT
TTCCTCGTGTATATAGTTTAACTGTGATTTTACTTAATATAGGTCAATGCTAAAGTTGCT
TGACGTCTTGGTTCAGCTGGATCATCTTAAAAATGCTAAAGCTAGCATTCCTAATGATTT
CTCTTGGTATAAGAGGTGAAAGATATAATACTTTTATCTTTCCTATCTATATTTTCTGCA
AATAGGACACTTGAATGTAAGTAGATCGATGTTTGTTACTAATCCTTTCAGCTACTAAAG
CTCTATTTAAGAGTTGAATTAGTTTCCTATGGGATC
GenBank Accession AL948587 [GenBank]
Graphic View Graphic view of gene At5g18410
Predicted Position of Insertion Chr5:6103492 - go to primer design
BLAST e Value 6e-160
Hit Clone Code (BAC ID) F20L16
Hit Gene Code At5g18410 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation transcription activators
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03