Sequences from confirmation amplicon


Confirmation sequences for line 314F05 and hit At1g74430 are shown.
Line ID 314F05
Locus At1g74430 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:27976413
Primers used for PCR RS08 - 8474, show primer details
   
Sequence Name 31-K017401-022-314-F05C-RS08
GenBank Accession LN499946 [GenBank]
Sequencing primer gene specific primer, RS08: 5'-GATTCAAAGAAGGAACAGGTCAAG-3'
Sequence (A. th genome BLAST matches underlined)
>31-K017401-022-314-F05C-RS08
CGTACACTCCGATCTCTGTATGGGTCGATTAATGAGTAGTCGTCAAAAGCCACGAAGCCA
GACGTCGAGTCATCACAAGGTAGTTCATCAATACTCATCGTCTCATCAATCTCCATGTAA
CAACTAATCAATTCCTTCTCTTTCATGTTAATTGTCATCATCTTCTCTTCATCAACGGCT
TCTCTTGGTTGTTCTGCCAATATCACTGTCTTGATACTCTCTAGTCCGTGTTTTCTTGAC
GAGATTCCAGCAGCGAGCTTGTTAAGGAAACGTGCAGAGCCAGTAGAGGAACAGGAGGAA
AAAGAAGAAGAAGTAGGGCTCGGTGTAGGAGACGACGTAGTTGATGAGGAGGTGACATCG
ACGGTGAGGCTTGTTGTTGTTGTTGGCTCATGGGTCATTGGATCGATTCCTTTTTTAGCA
AGTCTTTTCTTAAGGCATGAGTTCCAATGGTTCTTTATGTCATTATCTGTTCTGTTTGGC
ATTTGCTTAGCTATTGCTGCCCACCTTGTAATCATGTAATTTTTTAAGGACCATATTACT
AAAATGATATAAGACGACATTATTGATTGAATAATTATTGATCAAAGATGGGTTTAGGGT
TGCATTTAATCACAAATAAATTAATTATATACCTGTTTCCAAGAAGAGCATGGTATTAAT
TATTTGAGGCCTGGGATGGCTGAATTATTTGTTTCCAGGATATATTCAATTGTAAATGGC
TTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATA
   
Sequence Name 32-K017401-022-314-F05C-8409
GenBank Accession LN500372 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>32-K017401-022-314-F05C-8409
AGATTTTCCGGACATGAAGCCATTTACAATTGAATATATCCTGGAAACAAATAATTCAGC
CATCCCAGGCCTCAAATAATTAATACCATGCTCTTCTTGGAAACAGGTATATAATTAATT
TATTTGTGATTAAATGCAACCCTAAACCCATCTTTGATCAATAATTATTCAATCAATAAT
GTCGTCTTATATCATTTTAGTAATATGGTCCTTAAAAAATTACATGATTACAAGGTGGGC
AGCAATAGCTAAGCAAATGCCAAACAGAACAGATAATGACATAAAGAACCATTGGAACTC
ATGCCTTAAGAAAAGACTTGCTAAAAAAGGAATCGATCCAATGACCCATGAGCCAACAAC
AACAACAAGCCTCACCGTCGATGTCACCTCCTCATCAACTACGTCGTCTCCTACACCGAG
CCCTACTTCTTCTTCTTTTTCCTCCTGTTCCTCTACTGGCTCTGCACGTTTCCTTAACAA
GCTCGCTGCTGGAATCTCGTCAAGAAAACACGGACTAGAGAGTATCAAGACAGTGATATT
GGCAGAACAACCAAGAGAAGCCGTTGATGAAGAGAAGATGATGACAATTAACATGAAAGA
GAAGGAATTGATTAGTTGTTACATGGAGATTGATGAGACGATGAGTATTGATGAACTACC
TTGTGATGACTCGACGTCTGGCTTCGTGGCTTTTGACGACTACTCATTAATCGACCCATA
CAGAGACGGTGTGTACGTATCTGATTTCTACGATGAGACTGAACACCTTGA

Last Updated on 23.10.2014 13:25